GenePrediction:GLEAN_1080 Details

Name: GLEAN_1080
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:452286..454322 (+ strand)
Length: 2037
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:452286..452331 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_173:452433..452959 (+ strand)
Length: 527
Type: CDS
Source: GLEAN
Position: GCSC_173:453019..453952 (+ strand)
Length: 934
Type: CDS
Source: GLEAN
Position: GCSC_173:454021..454194 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_173:454252..454322 (+ strand)
Length: 71
>GLEAN_1080 class=GenePrediction position=GCSC_173:452286..454322 (+ strand)
ATGGGTCTGGGCATTCTCGAAGACCGGGTCATGAGCCACGTTCCCGGTATGTGAATTGGTCGAGGAGCCAATTTGACGAT
GCACATGCACAGCGATCCTGCACACCACCTGAACACCACCTACCCCCCTCCCGCTGACCCTCAACAGGCACCACCCGTTA
CTTTGACGACCCTCAGCGGCCCCAGATCGCCCACGACGGCGCACCTGGTCTCAAGTGCGACTACAGCGGCGGCGTGCCCA
TCATCTTGATCCCGCAGCCGTCGGACGACCCGAATGACCCGCTGAACTGGCCGCTCTGGCGTCGCGACCTCATCTGCTTC
ATCCTCTCGGTCTCCGCCATCTTTGCCACCGCCCTCGGTCCGATCCTGGCCGCCAACACCATCACGCTCTCGCTCTGGTT
CGAGGTCGACTTCACTAAGGTCGCCCTGTTGACCGGCTACTTCCTCCTCGGCGTCGGCTTTGCCGGCACCTTTTTCGTGC
CCTCGAGCCGCATCTGGGGCAAGCGCCATGCCTTCATCTTCGGCATCTGCCTCCTCATCGCCAGCAGCGTCTGGGCCGGC
TCCGTCAACCGCAACTACACCAGCATGCTGTGGGCGCGCATCATCCAAGGCGTCGGTGCTGCCCCGTTCGAGGCGCTCGT
CAATGCGTCTGTCGGCGACCTGTACTTTGTCCATGTACGTTGTGTCTGCCCGTCTGACTCTTCCCTACCTCTCTTCCACT
GACATGCTCACAGCAACGCGGAAAACGGATGGCCTTTACCAATCTCGCCGTCTTTGGGGGCTCCTTTTTTACCCCGATTC
TCGTCGGCAAGATCACCCACACAATCTATTGGTGGTGGACCTTTTACCTGGTCGCCATCTTCTGCGGCGCCTGTCTGCCG
GCCATCATCCTCTTCTGCCCTGAGACGGCTTTCAACCGTGACGCCGCCCTCAACACCGACACGGCCGACACCGATGTCAT
TGGCGCAGACGCTTCGCGCGTGGTCCAAGTCGACGCAGACGGTGCTGCGGCTATGGCGATGGCTGATGGCGCAAACAAGG
ACGAGATCGACCCATCTGACCCGTGCGACTCGTCTGGCAACGACGAAGAAAAGGCAGCAGCAGAGGCGACGGCTGGCCGC
AGCGGTGCCATCCCGGCCAAGAAGACCTGGCTGCAGAACCTGGCTCCCTTTGACGGGCGCAAGTCGGACGAGAACTTTAT
CAAGCTGCTGCTACGACCGTTTCCACTCTTCCTGCAGCCGGCCTTTCTCTGGGCCAGCCTGACGCAGGGCACGCTCATCG
GCTGGACCGTCTTTATCGGCGTCATCATGGCCCAGTTCTTCCTCGGATATCCTCTGTGGTGGGACGAGGTCAAGACCGGC
TACGCGTACACGGGCGCCTTTCTGGGCGCCGTCCTGGGCTTCATCATCGCCGGCTTGCTGGCTGACTGGAGCGCCAAGTT
CTTGACTCGGCGCAACAAGGGAATCTACGAGCCCGAGTTCCGCCTCGTGCTCGTCATCCCGCAGCTCGTCTTTGGCGTCA
TGGGGCTGTACGGCTTCGGCATCACCATTGACGGCATGATGAAGCTCAAGTACCACTGGTCGGTGCCGCTCGTCTTCTTC
GGCTTCGAGGTCTGCGGCATGATCATCGGTGCCGTCGCCAGCAGTCTGTACATTGTTGATGCATACCGTACGTTCCTGAT
CCTGAATCTGCTTGCACTTCCCCTCTTCGATGCTCCTGGCTAACCCGTTAACCAGGTGATCTTGCCATTGAGGGCTTCAC
GTGTCTCATCATCTTCAAGAACTTCTTTAGCTACGGCCTAACGTACAAGGCCTACGATTGGCTGGAGGAGAACGGTTCTC
GTGGCCGGCCGGTGTTCAACGCCCTGGGAAGCGTACAGCTGGTCATCTGTCTGTTAGCCATTCCGATGTGTGAGTACTGG
CTTCCGTGTTGCCCGGTACGGAGACTTGCATTGCTAATTCATTCAGACGTGTTTGGCAAACGCAACCGAAGCTTTTTCCA
CCGTCACGACCTGTTGAAGATGTTCGGGCTCCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62