GenePrediction:GLEAN_1082 Details

Name: GLEAN_1082
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:476422..478828 (+ strand)
Length: 2407
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:476422..476676 (+ strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_173:476724..477318 (+ strand)
Length: 595
Type: CDS
Source: GLEAN
Position: GCSC_173:477366..478828 (+ strand)
Length: 1463
>GLEAN_1082 class=GenePrediction position=GCSC_173:476422..478828 (+ strand)
ATGATGCCTTCTAGCACGGCAAAGACCCATCAACTGGGTCGCCAGGTCTGGACGACCGTCCGGGAATCGTTGGACTCGTG
GGTGTGGCATCTGCCCTCCCGATCGCCTCCCCGTTCGCTGACTGGCCTGGGCATCGGCCACTCCTTTGCGTCGCAGGTCG
TCAGCCGGGAGCCCATGCGAAGGTCCTTCTTCCACAGCAGTAGCCGGAGGCTTTTCGGTCATTGCGCACCTGCCACTAAG
ATCTCGCCGAATAATGTGCGCCGAAGTTGCACATCTGGGGGTCTCCTACTCCTGGGGCTAAGCTCGCCGTCGACGTCATC
GTCCGGCGTCGTGGCCACGTGCACGGCCGCAGCCGACACAGCCATGAGCGGGACCACAAGCCAAAAAAAGGCGAGCATCG
GCCGGGCGGCTCGGCAGGCCTGGCAGCAGCACCGCAGCCACCACACGCTCCGGCGAGGACTGCCGGCTGTCTGGAAGAAA
TGACGCGGCGATGCGAGAGCACGTCAACGAGCGACAGTGCCAAGAGAGCGGTCGAAGCGGCGACGCCAGCTAAAAAGAGC
CCAGGCGAAGTGCCAGAACCGCCACCACCACCACCACCACAGCCCGGAGACGAGGAGTCTATAGCGGCATCGATGTCAAA
GTACCTGCAATCCCACCTGCCCAAGATCCCGCAGCGGCCGACAAAAGAAGAGTTTATGGCGGCAGCGACGGGGTTCTGGC
AGCGGCTGCAGGCGCGTTTCAAGTGGCACTCGATCCGCAGCATGCGGCCCTGGAATGCGGACGAATGGGGGGCTTTTGTG
TCGTGGATCATGCTGGGCCACCTGTTGTGGATTCTGGTCGGGACCACGACCTTCTTCTCGATCGTGATCCTGCTCATCAA
CACCGTGTTTGCGCAAGGTATGTTGTCTGGTATTTGGAAGCTACTTCATCGCTAACGAATACAGAGGAACTGGCCAAATG
GGTTGGTGACTACCTGACGCAGTCGGCCGGCGTGACGGTCGTGTTTGAGTCAGCCATCGTGCCGAAGTGGAAGGGCGGCG
TGATCACATTCCACAACGTGTTCGTGTCGCGGCGGCCGGGTCAGGTGAAGTCGTCGGTCAAGAAGGGCTCGTCCAGCGAG
GCAGCGATTGCAGCAGCCCAGCAGAGCCACGAGCCGGACGGCGCAGCCGTGACGGTCGAAGACCACGACGACGGCAACTA
CACGCAGTTCGACGTGACGATCAACAGCGTGGATGTGTCGCTGTCCTTTGTCAAGTGGTGGAATGGCAAGGGCCTTTTGC
GGGACGTCGAGGTGAAGGGTGTGCGCGGCATCATCGACCGGACTCACGTGCAGTGGGCAGCCGGACCGCTGGATCCACTG
TCGTTCCGTCACGTCCATCTGCCGGGCGACTTTGAGATTGAACGGTTCAAGCTCGAGGACCTGATGGTGACGGTGCACCA
GCCAAGCGGATTCCGGCCCTTCAGCATCAGCATCTTCTCGTGCGAGCTGCCGCAGCTGCGGAAGCAATGGCTCTTGTACG
ACTTTCTCTCGGCCAACCACGTGTCTGGCTCGTACGACGGCTCTCTGTTCACCATCCACCCGCGTCAGGTGCAGCAGTCG
CGGGCGCTGTCCGCGCCATCATCAGTGGCAACAACGACGATCGACGACGTGGTCGACCGCAGCCACCACGACATCAGCAA
TCCGGCCAACGAGCCGGTGATGCTGGAGTCGCCGCTGGCGTGGAAGAAGTTCTCGCGCCTGCGCATTGACGGGCTCAAAA
TTGACCACCTCAACCGGGGCGACCGTGGGCCGTTTGGCTGGATCTACGAGGGCAACGTCGACATTGTGTCGGATGTGATG
CTGCCGGCCGAAGCCGACGAGGGCATCGCCAAGGCCGTCAGCGACCTGTACGACAACTTCTACGACCGCATGGAGGAGGC
CGTGACGAGCAACCGGTACATCACCATCCTGGACGGCCACTACGGCTCGCGGCGGGAAGAAGAGGGAGAGCTGCCCCAAG
ACGAGCCCGGGCAGCTGGCCGACGCCTCGCCGCCGCAGTACGTCGTCATGGATCTGCGGATGCACCTCAACGACATCCGG
GCAGCCGTGCCGTTCTTTCCCGCGTCCGAGGCGCTCGGCTACGTCAACGCGGCGCTGATCCGGCCCATCGTGGCCTACAT
GAACGCCAAGCGTACGTATATACCCATCAACTGTCGCATCGTCAAGCACCTGTCCGACTTTGACGGCAGCTGGACCATCT
ACGACTGCGGCTTAATGGACGACTCGTCCGCCGAGGTATACGCCGCGTTTGCGCACGATGTCGAAGACCAGCAGTCGCGC
GTGCGCCGTCTCAAAAAGGTCGGCTTCTGGACCCTCAGCATGGTCGTGCATGCCATCCTGGCTGGCGTCGCCGGCGATCT
GCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62