GenePrediction:GLEAN_1083 Details

Name: GLEAN_1083
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:482413..485735 (+ strand)
Length: 3323
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:482413..482851 (+ strand)
Length: 439
Type: CDS
Source: GLEAN
Position: GCSC_173:482938..483969 (+ strand)
Length: 1032
Type: CDS
Source: GLEAN
Position: GCSC_173:484673..485517 (+ strand)
Length: 845
Type: CDS
Source: GLEAN
Position: GCSC_173:485580..485735 (+ strand)
Length: 156
>GLEAN_1083 class=GenePrediction position=GCSC_173:482413..485735 (+ strand)
ATGAATTTCAGCCGTTGGATTGCGGCGTACCGGGATTTCGGTGCCCGGAGTCCATCCTACACGGCTATGGCCTCCAACCA
GAGTTCCTTGGGTTTCCCCGAAAAGTATCGGCTACACTCGCGATTTCAACGGCTATTTGCCTGTACAGCCATCGTCCTCT
TTGCTATCATCGGCGTGGCTGTCTACTCAAGGGAGCACGACCTGCTGCCAGCTATACTCTCTCGTCCGTCTAGAGCGGAA
ATGACCAAAGAGGACTACATCAATGCCGTCCTGCGCGACCCAGTAGAGGGCCTCCTCGACCCCGAGCCCATCCGCAAGAA
ATGCAACGAGACGCAGTACCAAGAGGGTCTCGTCTGGCACTGCGACACCGTCGTTGGAGGCATCGGCAACGTGGGAAACA
TGTGGCTGAACTGCGTGCGATATGCTATGGAAGCAGGAGGTGCGTGTTCTGCCGCTCACTCTTGTGTCCTTGGCTTGCAA
GACTGACTTTGGTACTAGCTACAACTCTGATTCTCCCCCGATTAGGCGCCCGCAGCGACAACCTGATCGACCTGGGCAAC
AAGGACCACTCGGTCGACCTGAGCTACCTCTTCGACGTCGACTACTTCCTGGTTTCGTGGAAGGAGGTCTGCCCGCGGAT
CCAGGCCGTCGTCTCGGACGCAGAGGTGCCCGACCTGCCGCCAACGCCGTCAGATCGATCACCACACCTAGCGCCCAGCC
GAGTCAAGTCCTTTCCGATGCGCAAATACCTGATCGTCGACCCGACCGGCTGGCGCGAAGCCTTTGATGCCTGGCTGGCC
AAGGTGCCAGCACCGGCCGTGTCGGCCACGAGCCCGGTACGTGTCTGGCAGGACATGGTGCTGGCCCAATGGAACCGCGA
GGCGAACTCGCCCGCGTTTGGCAATGCCTTTCCGCGCCTGTTTCGCTATCCCCTGCAGACGCGCCGGCTGGCGGCCGCGG
CGCTGTGGAGCCTCGAGCAGAAGATGGGCCGCCCCGTGGTCGCCGACAGCATCTTGTTTTCGGCCGACTCCCCGACGGCC
GAGCTGCCGTCCACCTCTCAGGCCAACTCGCTCGGTCCTGGACGGCTAGCACCAGCTGGCTTCCTGGGCGCCCACATGCG
CGTGGCTGCCGACGCGGCGGCGGCTGGCTGGCCCGGCTACGAGGCCCAGGCGCCCTTCTTCATCACCGAGGCCAAGCAGC
GCAACTTGACGACGGTCTACCTGGCCACGGGCTCGGACGAACACCGCGAGCGGTTCCGCAAAGACGCCGCCGCCGAGGGC
CTGCAGGTGTTCACCAAGGAGGACCTCCTGGAAGAGCAGGAGCTCGCCGAGCTGCAGACGCTCACGTGGGATCAGCAGGC
CCTGGTCGACTTTGAAGTGCTCGTCCATAGCACCTGGTTCTACGGCTTCGTGCGCAGTAGCTTCAGCTGGGCTCTCGCCC
TGCGCCGTGGCACGCTGCCCGAAGCCGGCCCATCACAGGTGACCGACCAGCTGGGAGACGAGTTCCGGGACAACATCAGC
GCCGTCGTCGGACGCCATCCCAACATCAACCCAGAGGGTATGTGGCCTTGATCTTTGTTCCTTTCGATGACGAAAAAGGC
AAGATCAAAGAAGGAGGCAATCGGCAAATTGCATGTAATGATAGTAGATTGGTAGACTTGGGATATGGCATGGCGGATGG
GCATGTTACGCGTTCTGTTCTCTGTGTTTGGTGCACGAAAATGAAGCGGCAGGAAGCCAGCTCTTCAAACGAGAACTTCC
GAAATATTGCTCATCACATGACCCGGTGACTGGTCGGGAACTTCGATCGCCGCTTCCGCTAAGCTGTCAGAGCTAACATT
CGTCTGAAAGGTCGATTATTTCGCCGTCTTCTTACTCGGAGAATACTCGGTGTACTTTCACTACTCAGTCGGGGTTGTCT
ATTGTGGGCTACCGGGCGAATCATGAAAACTTTGATAGTCACTCGTGGAGAAGGTGTCTTTGCTTCTGCCGGCTTGTCTT
CGTACTGCCCGGACAGCCTCCGCGTTTCGCTCAGCTCCGTGACCACAGGTACCAGGCTGACACGGTGAATGTCCGAGGCC
TGTCTTACTAACACGATCTTACTCGTATATATACAATGTCAACTGGAAAGAGACATGGACTCTGCCTGGCTTTGTCTTAC
AGATATTGACTGGACCAAGCAACCAACAAACGCATTTCTGCCATCTTATTTGCCAGCCAGATCCATCCATATATCTGTCC
TTCCGGAATGACCACAGTAGGGATTCGTGCGGCCGCCTTGAGCCAACCACGGCTGGTCGGCAAGCAGCTTGCACGTGCTC
TGCCCAGGCGGCCTTTGACAGTTGCTGACTGCTTCTCGACGACGGCTGTCGTGCGCAAGCGTGACGTCTTCCCGGCCCAT
GAGACAGAGCACATCCGCCAGACACCCCCGGCCTGGCAACACCATGGATACACCGCGGAGGAGATGCTGGCGGTCAAGCC
GGGCCACCGGCCGCCCGAGACCATGGGTGACCGGCTGGCCTGGCGCCTGATCCGCATTTGCCGCTGGGGCATGGACACGG
CCACGGGCATGAGCAGCAGCCAGCAGACGGACGTCCGGAAGCCAACGACGGCGGTGGTGGCCGAGAAGCCGCTGACGGAG
GCGCAGTGGCTGATTCGGTTCATCTTCCTCGAGTCCATCGCCGGCGTCCCGGGCATGGTGGCCGGCATGCTGCGCCACCT
GCGCTCGATCCGGCAGCTAAAGCGCGACAACGGCTGGATCGAGACCCTGCTGGAGGAGTCGTTCAACGAGCGGATGCACC
TCCTGACCTTCTTGAAGATGTGCGAGCCCGGCCGGTTCATGAAGCTGATGATCCTCGGCGCCCAGGGCGTCTACTTCAAC
GCCATGTTCCTGTCGTACCTGATCAGTCCACGCATCTGCCACCGCTTCGTCGGCTACCTCGAGGAAGAGGCCGTCCACAC
GTACACGCGCTGCCTGGCTGAGATGGACGCCGGCGGCACGCCGCTCTGGAGCGACCCCGCCTTCAAGGTGCCCGAGATTG
CCGTCAAGTACTGGCACATGCCCGAGGACAGGCGCACCATGAAGGACTTGATCCTGTATATTCGGGTATGCATCCCAGCT
CGGGCAAATGCGCCGCTTGGGCGTTCCTGCTGACAGACCGACGTTAGGCCGACGAAGCAAGCCATCGTGGCGTCAACCAC
ACGCTCGGAAATCTCGACCAAAACGAAGATCCAAACCCGTTTGTGAGCGAATACAAGTCCGGCAACGCACCGCCCAAGCC
GATGGTACGGCCTGCCGGCTATGAGCGCGAAGAGGTCATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62