GenePrediction:GLEAN_1084 Details

Name: GLEAN_1084
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:487985..490220 (+ strand)
Length: 2236
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:487985..489122 (+ strand)
Length: 1138
Type: CDS
Source: GLEAN
Position: GCSC_173:489199..490220 (+ strand)
Length: 1022
>GLEAN_1084 class=GenePrediction position=GCSC_173:487985..490220 (+ strand)
ATGGATTCAGTACAGCCTTCCCGCGGCCGGTCGCCATCGCTTAACATAAAGCAAAGCCACTCTCCATCGCCATCCCCTGC
TCGCGCCTACAACAATAACCTCCAAGCCATCTCGAGCAACCACAACATCGGCCTTGGCCTCATCGACCCCTCTTCCCAGC
AATTCTCCTCGCAGCCTGGCTTCTCCGCCTATAGCAACGGTTACCTAGCTACCACTCGACCTGGGCTAGAACAGCAAAGC
CTCGCCTTTGATCACAATCAATCCTTCGTAGACCAGCTAAAGACCGAGCCTGCCAACCCCCCCTTCAACCAAGGCTATCT
AGATCCCCAGCAAGCCTACGGCGAGGATTTTACCATATACCCCTCATCAACGTCGGAACAGCTCTCCACCCCGCTGTTTG
ATCAGCAAGAGCAGTACGGCGTACAAGACATCAACATGGCTACCTCACAGGCATCGCACAGCCCTACCCCTCCTCATCTC
CTCACTATTGACGCACTCCCGGGCTCGGCCCACCAGTCTCCATCATTCAATACCCACCAATTTGTCCCGCCCACTGGGCG
CCACTCCCGGCATGTCTCTCTCAGGCCTGAGGCTGCTCTGCTCCCGGGCCAAGAATGGACGGGGCCCCATTTCCAAGGAC
ACCGGCGAAACGGCTCCGAGTTTTCCGACGCCTCATCCATCGGAGGACATTCACCATCCATAGCGGGCCAGGACACATTT
TCCGATCCTGCAGATCAGATTACGAGCTCTCCCATGCTACAACCGGAAGAGGCCGGCGACGTGTACCGGGAGCTGCGTGG
CATCAACAGTTTCAGCATCTCAAACAACCAAGCGGGCCGCAGCCCCTCTCACAGTCCCGCCATCTCGCCACGACTTCTGC
CCCAGTCGGTGGCAGAGATGGGCACAGCTTCTGGTTTTTTGCTGCAAAACCAAACCGACAGCTATTCGTACTACATGCCA
TCCGGCCATGGCTCTGAGGCCTTTCCACAGCTGCCCAATAGCGACATCCCCCAGCAAATGTCTCAGATGTCGGCGCCGAA
AATCGAAATACAATATGCACCGCCCAACACGGCCAACCGCAATGCCTTTGCAGGCAAGCCGGTCATGGACACGGATGCGC
TGACACCCCCCGACCGAGGTAAGACAAGCTGCTTTAGCCGAGGTGGGGACCGCCATGACATGGATGATATTGACACTTGT
GCCACTTTCTTCAGGACGTCAAAGACGCCGTGCGATCACAGACCCATACAACGGCGGAGGGATGGCAGTGGGCCATCAGC
ACAATGCCGGCAGTCTCTCGCCGCATATGAGAGGCGATCAAACACCACGTTCCGACAGCTCTCGATCCTTGTCTCCCTTT
GAGCGATCAGGCAGCGCGGTTGCTGGAAACCGGCGGCGGCTATCGTACGTCGGCCGTCCCCCCAACAACGCCATGGCTCT
GCGGCTGGCGGATCCAGATTTCGCTGCGGCGGGGACAATGGACAATGGTATCGTCAACGGTGCGACAGGGACAGGCGCGA
AGCGCGCCCAGAAGCACCCGGCAACATTCCAATGCTCGCTGTGTCCAAAACGCTTCACGCGGGCGTACAACCTGCGCTCG
CACTTGCGCACACACACAGACGAGCGACCGTTTGTCTGCTCCTTCTGCAGCAAGGCGTTTGCGAGACAGCACGACCGGAA
GCGACACGAGGGCCTTCACAGTGGCGAGAAGAAGTTTGTGTGCAAAGGCGATCTCAAGATCGGGGGCGAGTGGGGGTGCG
GCCGCCGGTTTGCGCGCGCCGATGCTCTCGGCCGACACTTCCGATCAGAGGCCGGACGGATCTGCATCAAGCCGCTGCTC
GACGAAGAGACTCTCGAGCGGCACCGGGCTTGGCAGGAGCAAAACATGGCGGCCCAAGCGGCTGCACAGCAGAACATGAT
GCTCTCGCAACCTCCGCCGCAGGTCGACCCGAACACAGGCTATCCGATGGATGCTTCGGGCAACTACATTCTCCCGGCGG
CACTGTTGGCGCAATACCCGGCTTTGGCACAGGTGAACTGGGCAGCTGTCGACATGAGCGGCGCAGGATCGGGAATGGAA
GACGATATCAGCGGGCGCAGCAACTTTGACGCGAGCGACTTGGACGACGGTGATGATGGTGGCTATGTTTCCGGGCCTGG
CACCGGCTATGGTGAGGGCGGGATGGGCGAGAATTTTGGCGACATGGGCTATGCATCTGATTATGGTGGCCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62