GenePrediction:GLEAN_1085 Details

Name: GLEAN_1085
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:490910..492164 (+ strand)
Length: 1255
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:490910..491202 (+ strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_173:491273..491402 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_173:491463..492164 (+ strand)
Length: 702
>GLEAN_1085 class=GenePrediction position=GCSC_173:490910..492164 (+ strand)
ATGACTTCGACAGAATCGTGGCCGGCTACCACCAGGGCCATTGTGATCCGTGGCAAGGGTGTGGCTGCCATTGACGAGGC
GGCGCCTGCGCCCAAGCTGCGTGACGGGTACCTGCGGGTGCGCACCACTGCTGTGGCCCTCAATCCGACCGATTGGAAGC
ACATTGATCATGTGTTGGGCGACCCGACCGGCGCTCGTGTTGGCTGTGACTATGCCGGCATTGTTGTGGAGGTTGGCAGT
GGCGTGACCCAGTTCCAGCCGGGCGATCACATTGCCGGAACAGCCCACGGATCGTGAGTTGGCGGAGACGCCGGACGGAT
GACTGCGTAGCTGCTTTGATCGATCTGCTGACCAGCCGTTCAGCAACGAGAGCCAGCACGAGGATGGCACGTTTGCCGAG
CACATTGTGGTCAAGGCCGCGCTCGCCTTTACGATTCCGAAGAACCTCAGCAACGTGGAGGCGGCCACGCTGGGGCTGGG
AGCTGGGACGGTGGTATGTTGCTGCGTTGTTTCGTCCTTCGGCCTCCGTCTTTCCCACGCTGACGGCCCATAGGGACAAG
GCCTGTACCAGGCGCTCAAGATGAAGCTGCCGACGGAGCCGCTGACGAAGCCAGAGCCGGTCCTGATCTACGGCGGCTCG
ACGGCGACAGGCGTGCTGGGCATCCAGTTCGCCAAGCTGTCGGGCTACCGTGTCATCACGGCGGCCTCGCCGCACAACCG
CGCGTACCTGCAGTCGCTCGGCGCCGATGCCGTCTTCGATTACCACGACGCCGATGCCTTTGTGGCCGACGTGGCCGCCA
CGGTCAAGGCCTGGGGCCTCGGCGGCCTGCGCCTCGTCTGGGACTGCATCTCGTCCGAGCAGACGGCTCGGCTGTCGGCC
CGGGCGCTCTCTGCTGCCGCCGGCGATGACAGCACCGCCACGTTGCTGTACCGCAACCTGCTGCCCGTCCCGGCCGACGT
GCTGACGGCGGTCGACCGGCGCATCGACAGCGCCGGCACCTTCTTCTACACGGCCCTCGGCGAGCCTTTTGTCAAGGGCA
TCGCGTTCCCGGCCGTGCCCGCAGACTTTGCGTTTGCCACGCGCTTCATCGCCCTGACGGCCGACCTGGCCGCGTCTGGC
AAGCTGAAGCCGGTCAAGCCGATCGTCAACCGTGGCGGCGCCGGCCTCGACGGCGTCCTCGTCGGACTCCAGGAGCTCAA
AGCCGACAAGGTCAGCGGCGGCAAGCTCGTGTACACGATCGGGCCCCAGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62