GenePrediction:GLEAN_1086 Details

Name: GLEAN_1086
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:497326..505795 (+ strand)
Length: 8470
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:497326..497529 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_173:498032..498281 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_173:500554..502921 (+ strand)
Length: 2368
Type: CDS
Source: GLEAN
Position: GCSC_173:503074..505795 (+ strand)
Length: 2722
>GLEAN_1086 class=GenePrediction position=GCSC_173:497326..505795 (+ strand)
ATGGCCGCCGTCCAGCTTCTTGCGTTGCGCCCCAACAGCGTTACCGTAGAAGGCGTCGCATATGGCTCCTCAACGACCCG
ATATGGGACAAAGGCGACTGGGTGGGATGATGGCGCGGAGGACAGCTGTTCTGGTGTCCCCTGGTCTGCTGAGGACTTGC
GCATCCGCATGCGCTGCATTGCTTCGGCCTGGACACAACTTCGGGTGAGATTTCTCTTCGTTTTGCTCCTTTCTCTAAAC
CCTACGCCCTACCTCTCCCTGTACCGTGTTGCGCTTGGCACTATCATGTCTTCCCGTCTGCCATATGTGCCTGTTTTACT
CTGTATATACGCGCAATGGTTCTGCGGCAAGCAGGCGGCTACACACGAGAGGGCGCCATATGATATTACCACTTCGGTCA
GGTTTCGATATTTCTATTTCTCTTATATTTGTACATTTTTGCCATATTTTCTCCCCTCCAAATTCCCATCCTTTTGCCTC
TACTGCCTCCTGGAGAGAGAGCCTCTGCTTGCATGCATGCTGGCGGCTCCTGTATATGGGCCTGCCAGCCTTGCAAATTA
AGCCGCTGGCGGGTCAACTGGGTCTCTTAATATCCATCCTGCTACCACGTCAAAAACAATTGTTTGGTGCCATGGTGGTC
CTCGACTTACACTGTTTTCTTGGAAAACGACTTTGTTGATGACATGTACTGATGACTTTCTGTTAGGGCCTGGTGGCTTC
TTCACAAGTCTCGAAAGTCCATCTGACATCAACACGCAAATTCATATTACCAAGCCTCACCCCCAAATGGGCTCGTAGCT
TCCACCCATCTTCCACGTCCGAATCCGACTTTTTGGATGACGCGCCCATATCGGACCCAAGCCGAACTGGTGACCGACCG
AGTGAGCGAAATTGGGCAGATTCTGGTCTTGGCGACACGCCTTCACAGGCCGAGTCCGATCGTCGCAGGCACAAGAGTGA
CTCTGGTCTTTTTCGGGACCCTTGCCTGGACACACGCGTGAACTTTTTGTCTACAGAAGGCTTCAAGGAGGCCGCTCCGA
AAAAGAAAAAGAAAAACCAGACGAACAGCTCCAACAATAACAACAATGCGAACAACAATACAAATAACAACAATTATAAC
AGCAACGACAACAATAGCAACGGCGCCGATAAGAAGGAGGCTGCGGGAGGCGACGCGGGCAGGGGCATTAACGGTGGCAG
CGGAGATGGTGGTGACGACAAGAAAAAGGGGGATGACGCCGCACGAGACATCGCCACGACCGACATGAAGAAGAAGGGCA
AGAAGAGCGATGCATTACTCCCAGATGTCTCTGCAGCAGGGGACGTTGACGCGTTTCAGGAGATCACGCTCAACGATAGT
GGACCAGCTTCGCAAGGCTGGGGATCAGTTGGGGGTTCTGGCAAAACCGCTACCACTGGTCTCGCACGAGGCGCATCTGA
TGACAAGGCCGAGGAAGATGATAACTCGTGGGGCGCCAACCGAACTAAGCTCAAAAAGAAGAAGACGGCACTCGGTTCCG
GCGACTTCGGCGAAGACAATCTAAATTCTGCTGTATCTGCCGAGAAGAAAACGGAGGCTTTCTGGGACAGGACCGCAAAG
ACAGACACATCAGCCAAAACCCAAGAGGGGGAGGGATGGGGCTGGGGTTTGACAGGCGGCAAGAAGAAAAAGGCCGAGCC
GGAACCAGTACCGGAGCCGGAGAAGCCACTTACGGAGGCCGATTATACAACAGCAACTGATCCCTGGAGGCCATCACTAC
CAGCACCGAAGAAAGTCAAGAAAAATGGGAAGATTGCTGCGATGGCCAGTGTTTTCGAACCAGAACCTGATCCGGAGCCA
GCACCATCGGTAGAACCGGAACCAGAACCCGAGAAGACGAAAGAAGACGAAGGTACCTGGGATATTTTCGGCATGGGCAA
AAAAACCAAGAAGAAGAAGGCCGACGAGCCTAAACCGGTCGAGCCGGAGCCGGAGCCAGAGACAGAACCGGCATTTCGGG
AAGAATCGCTTTGGGGGTATTCTGCACCGACAAAGAAGAAGAAAGCGAAAGGGGCTGCTGCTGTTATTGTGCCTGAGCCA
CTCAAGGAGCCCAATCCAGAACCGGAGGCAGAATCAAGGGACAGTGCCGAAAAGGAGGAGGGCGGCTTCTGGCCAAGTCT
GACAGCGAAAAAAGACAAGAATGGCAGGAAAAGCGATTCTACTCCTTACTTGGAGGCCCCCACACCGCCAAAGAACAGAT
CCTCTTATGATGATGAGTACGACTTGTTTGGAAGCAAGAAATCCAAGAAGAAGGCTGCGCCCGAAGAGGTCGTCGACTCA
CCCGCTGCGGAATGCAAGATGGACAACTTTGACATTGGCTTGGGCGCATCTGCCTCCAGCAAGAAGAAGAAGAAAGGGAA
GGCCGCAGAGCCTGAGGCCAAGTCAGAGCTGATCCAAGATCCTGAACCAGAAAGCAAGCCTGACTCCGACGAAACGTTTT
CAGCCTTTGTCACAACCAAGAAAGATAAAAAGAAGATGAAAACTGCGGCCGTTCTTGTCGTTGAAAAGCCCGAGCCGCCG
AGGGATCCCGACCCGGATCCAGAGCTCGAACCTCCACCGGAGCCCCCAAATGGCATTCTTGGCGCTACCGACGACTTGTC
ATTCAATGTTTGGGGTACAACCATGCCGAAGAAAATGAAGAGTAAGAAGGGCAAGCTTGTGGAGCAGGAGCAGGAACCAG
AACTAAAACCGGTACCAGAACCAATAGTTGTCATTGAACCCGCACCCGAGCCTCAAAAACCTAAACCTGCGCCCGAACCT
GAGCCAGTCACACAACAAGAGGAAGAAGACTGGGGGTTCTCGTGGAGCAGTCGGAAAAAGAAGAAGGCGGTGGTCGACTC
TGGCTCTAACAAAGACTCGAAATCGACACATTCGGTGCCTGAACCGGAGGCCCCTAAGAGCTTCTTCGCCTCGATCTGGT
CTTCGGCAACTGGCAAAACGAGAGAGAAGACCCCCGAGCCTGCTAAGCCCCCCCCAAAACCGGAGCTTGAGCCGGAGCCT
GAGCCGGAACCTGAGCCGGAACCTGAGCCAGAACCTGAGCCGGAACCTGAGCCGGAACCTGAGCCGGAACCCGAGCCTAA
ATCCAGGCCTGCGTACGTGGAAGAGAAGGCTGAAGATATATGGGGTTCCAGCAGCTGGGGCAAACAAAGTAAAGAAGGGC
AACCAGAAGGGGCCTTTGCTGGATCCAGTGCCTGCACCTGCTCTGGAGGTCAACAAAGTGGAGGAGTCAAACTGGGGTCC
TGTATCGAAGAAGGAGAAGAAAAAGAAGGGAAGGGTTGCCTCTGCTCTAGCAGCCTTTGAGCCGGAGCCTCCAAAGAAGG
TGGAACCAGAGCCTGAGCCGGAGCTGGAGCCGGAACCGGAGCCGGAACCAGAACCGGAATCAGAGTTAGAGCCAGAGCCG
GAGCCGGAAAAGAAAGAGGAAGAAATCATCTTCATGACAAAGAAGGAGAAAGAAAGAAAAAAGGAAAGTCGGCGGCTGTT
ATGGAGCCCGAGGTCGCTAAAGAAGAACCCGCCAAGGTCGAGCCGGAGGCCGACCTATGGTCTACGGCCATCACCATCAC
CAAGAAAGAGAAGAAGAAGAAAGCCAAGGTGGTGGGGCCGGAGCAAGAACCTGAGCCTGAGGCAGACCCAGATCCAGAGC
CAGAACTATTGCCCCCTGCCCCTGACCCACCTACTGACGAGCCCGAGGACATGTGGAGATTTGCTCTCAAAAAAGGGAGA
AAAAAAGAAGAAGGGCAGCAAGACTATCGAGCCCGAAACGATGCCTGACCCCTCCGCCCGGGAGCTAGAGGATGATCCAT
TGAGTTTTTCTACGAAAAAGGACAAGAAGAAGAAGAAGGGTAGCAAAGCTGTCGACCCGGAGCCGGAACCTGCGCCTGAG
CCTGAGGAACCGGAAGCAGAGGTGGAAGCGTGGGGGATCTCTCTCAAGAAGGAGAAGAAGAAGAAGAGCAGTAAGGCTGT
TAAGCTTGAGCCTGAACCCACGCCCGAGCCTAGGGAATCGGAAACGGAACCAGAGTTTGACCCGTGGGGAATGTTTGTCA
AGAAGGAGAAGAAAAAGAAGAGCAGCAAGACTGTTGAGCCTGATCCTGAACCTGTGTCAGACCATCCAGATCCAAAGCCA
GAAGTGGAGTCGTGGGACCCCCCTTCAAAGAAGGACAAGAAAAAGAAGAGCAGTAAGACTGCGGAAGCCGAACGCGAACC
TACGCCCGAGCCCCCGGATCCGAAACCAGAGGCTGACACGTGGGCCTTTTCTCTCAAGGACAAGAAAAAGAAGAGCAGCA
AGGCTGTGGAATCTGTACGTGAGCCTACGCCGGAACCCCTAGCCCCAGGACCTTCTGCCGTCGAGACAGAGGACGACACA
TGGGGAACTACGAGCAAAAAGGACAAGAAGAAGAAGGGGAAACACGTAGAGCCTGAGCCAGAGCCGGAGCCTACGCCTGA
ACCAGAGCCAGAACCAGTAGTCGACCTGGGCGACAACATGTGGCCGACATCTTCTAAGAAAGACAAGAAAAAGAAGAAGG
GCATTGGTGTAGCTGAAGAGGAGCCAGAAAAGCACGAACCTGAGCCGGTGGCTAGTTTTGGCGGCTGGATGGGCTGGGGA
GGCAGCGCGAAGACCAAGAAAGAGACCAAAAAGATCAATATTTCGGACGAGCTTGACAACGCCGAAGCTGACGCCAAGAG
TGGGGAAGCTGAGGACGATTTACTCGAGTTTCACGACAGCCACGGCTCGGTCGACGACAAGCATGATGACAACCCCCCGG
AAGAGATTGCCGAAGAGGAGGAAGAGGAGGAAGAGGAAGAATCGTGGCGCTGGGGTATCGGCAAGAAAGTGAAAAAGAAG
AAGGGCAAGGCGGTGGCGGAAGCAGAACCTGAAATCCCATTACGTGCTCCAACACCACTTGATGAGGAAGAGGAAGAAAA
GGCGCCAGTCAGCAACGGCTTCTGGGATGACGATTTTGGTTCCCTGTCGAAGTCGAAATCAAAGGAAAAGGAGAAGGAGA
AGGAAAAGAAGAAGGAGCCCAAGCTGAGCAAGAAGGAACAAGAGAAGCTTGAAAAGGAAAAAAGAAAGGCAGAGAAAGAG
AGGGCAAAGAAGGAGGCGCAAGAGGCGAAGGAAGCAGAGGAGCGCGCCGCCCGCGAAGCTGAAGAGGAAGCGGCGCGAGA
GGCGGAGGAGGCTGCTCAGCGCGAGGCAGAAGAGAAGGTCCGCATCGAAGCCGAAGAGCAGGCTGCTCGTGAGGCTGCAG
AGGCCGAGATAGCAGAGGAGGAGGCGAGGAGGACGATGCTCCTAGAAAAGAAGGAAAGGATGCGCAAACTCCCCAAGAAG
GAGCAGCGGGAGCTGGATGCTCTGAACCAAAGCGCCAGCAAGCGAGCCGAAGAGATCGCTGCCAAGGAAGCCGAAGAGGA
GGCAGCGCGTGAGGCGGAGGAGGAAGTGGCGCGCGAAGCGCAAGCTGCACGCGAGGCTGAGGAGCAAGCTGCACGAGAGG
CAGAGGAAGAGGCAGAGCGCGAGCGTGAGGAGGCAGAGGCTGCAGAGGCTGCCAAGAAGTCCAAGTCCAAGTCATCGTCA
AAATCGAAAGACGAGAAGAAAAAGGACAAGGGCAAGAGCAAGGACAAGGATCGGGACCGAGAAAGAGACAAGGGAAAAAA
GACAAGGACGAGGACGAGGAAAAGAAAGAGGAGAAGAAGGAGAAGAAGGAGAAGAAAGGCAAGGGCAGAGAGGAGGAAGT
CGACATGTTCAAGGAAATCGAGGATGACCTGGTCAACCTCAGCCCCGAACAGATCGAAGCGATCTTGGCACCAAAGGTCG
AGCCCAAAAGCGAGCCCAAGAGCAACGGGACTTTCAGCTTCTGGGGGTCGTCCAAGAAGACAGGTTCGTTGCCTGAGGCA
TCGCCAGCGGAGGCCGTTGCCGAGGCTGAACCAGTAGCGGCAGAAACTGAGTCAGCCGATCTGTTGGACATGCGGCAGGA
CGCTAAGAGCACCAAGACCAGTAAGAGCTCAAAGAGGAGTAGCGTGGTTGAGGAGGTGACCAAAGACGCGCCACCGATCG
CGAGGGAAGTCGTGTCAACTTCCAAAACCAAGAAGGGCGTCAGCGGCAAGATTTCCGACCGCCTGAAGCTGTTTGAGGCT
GCAGCGAACGATTGGGACGAGCCAATTGTCGACGAAGCACCACCGCTTCGATCGCTGACCTTGCCGCCACCACCTCCACC
GCCAGCGGAGCCAACGCTGTCCGAGAAGAAGAAATCAAAGAGAGACAGGGCAGCACCGGTTATTGTGGAAGAGCCGGAAG
CAGCCCCACAAGCATCTTCATCCCGGAAGGCGCCCTCGCGCTGGTCTTTCGGATCGCCGCTGAGCTTCTCGGTCGAGGAG
AGCGAGAATGTTGACGAGGCGAACAGGCTAGCCAACGAAGACGAAGACGAGATTGTTGCCGTTATCGACATGGCATCAAC
GAAGAAACCGGGCAAGAAGGGCGCTACAAGCAAGGCGGCCAAGGCCAAAGCTTCAGCCGCTTCTGTGCCTCCACCAGCAC
CCGTTGCACCGACTGCAGACCCTGCCAGCCCCCCCACACCGCCGTATGAGCCAAAAACGTCGAAAAAGGATCGCCCCAAG
ATCAGTCGCGATGGAACGTCTTGGAATATGTGGTCGTCCGCCGCACCGGCTGCACCGCCAGCACCACCTGCACCACCCGC
ACCACCTGCACCGCCGACCAGCGTGCCGACGAAGCGGCAGGTGAAGCTGCCGCCAACATCATCCCGGCACCACAAGGCGG
AGGTGAAAAAGGACAGAGATGAAAAGGCAAGCTCCTCAAAAGACTCGTCTGGCTCAGACAAGGCTGAACGGTCTGACAAG
GCAAAGGATGTGCCGGCCAAGGCCATGCGGCGCCAGAGCGTGTTCACCAGCACGCCACCGATATCGCGCTCTGCCACGAT
GCGGGAGACACGGGAGAAGCACCATGGCGTGAGCAACGGAAGCAGGGCAACACGACGCAACTCGGTCGATGTTACGAATG
GGCCCGCATCGCCACCGCCGGAGCCAGCAGACATTGTTGGAAAGGCAGCCAGGATTCTTGGAGTAGGCCGTTCCGGAAGC
CGGCGGACTTCCAAGCACGTTGAAGAGGATGAGCAGGGCACCACAGACGCTGAGCCGGCTATCATGCGGTCGGAGCGACG
CAGAGCAAAGGTAAAAAGCAGAGTGCACGATAGCCGTGATTATGCGGAGGATCGAGGCGCTGATCATCATTATCGTCGTC
AGCATCACCGCCAAGCAGAAGAAGAAGTGATAGTGGACCCTCTGAGCCCGCCGAAGCGTGCGGATTCCACGTCCGCAAAG
CGATCTGGTTTTGCCGGCTTATTTGGAAAGCTGAACTCAGCACCGGCAGCACCGGCAGCACCGATGCCGCCTCGCGACTT
GCGACCCGAAGTACGACCCGAAGCACGGCGGCGACACACCGTACATAATGCGGCAGACGGGCGGGATGGGGCTGGCATGG
GAGACGCAGAGCAGGAGGCGCGCCGCGCTGCTCGTCGGGCACGCCATGCGGAACGGGAGGCAGCGGATCGGAAAGCAGCG
GAGCGTGCGGCAGAAGAAGCACGCCGGGCCAAGGATGAAGAACGACGCGAGCGGCGACGGAAACACGCAGAAGAGGCACG
GCGACTCGAAGAACGGGAAGCACGCAAGGCAGAGCGCCGGGCAGCAGAAGAGCGGGAGGCAGCTGAGCGCGAACATGCAG
ATCGTGAGCGAGTAGAGCGGCGACGGTTGCGCAAAGAGCGAGAGCGGTCTGAGGCCGAAGCGGAAGCCGGACGACACGCG
GAGCGACGACACCGCCACCGGACAGAAGTGCACGCGCCGGAGAGCGAGCGAGAAGACGAGGAAGAGCAACGTCGTCGGCG
GCGAGCCGAGAAGAAGGCGATGCGCGAGGCCTCGGACAAGAAGAAGACGTCGTCTCGGCGGCAGTCGGAAGCGGAAGAAC
AGCACGTATACTCGCGCCACGACCGGGAGAAGCGGGACAGACACGGGAAGCAGCCGAGCTGGCCGCACTCGGGCACGTCG
TCGTGGGTGAAGGAGCACTCGGACGCACCGCCGCCACCAGTAGTAGGCGATGCCGAAGCGGCAGCAGCAGAGGAAGCGGC
ACGGCGAGAGCGACGCGACCGGCGCCGCCACAGCCAACGCTACCACGACGGCGAGGCGACGGCAGCCGAAGACGACGGGC
GTCGACGCAAGGAGCGACGGGAAGACCGACGCGGCGACGATCGACGCGGCGAAGACCGGGACCGCGAACGATACTATCGG
GACCGTGATCGTGGTGAGCGCACTCGTGGTGACCGTGGCGAACAAAGACACGAGCCACAGGCCGGATCCGAAGGCAGCGA
CGTTCGCAATGGCGCCGCTTTTGACCCGACGCCGCGGAACACCTGGTGGCGAAAGTTTACGGGAGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62