GenePrediction:GLEAN_1088 Details

Name: GLEAN_1088
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:506972..507647 (+ strand)
Length: 676
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:506972..506985 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_173:507056..507647 (+ strand)
Length: 592
>GLEAN_1088 class=GenePrediction position=GCSC_173:506972..507647 (+ strand)
ATGTTTAAGAAGGAGTGAGTGCTGGTAGGACGAGACTGTGTGTGTGTGCCGTCTGCCTGGTGCAACTGCTGACCGTCGCC
GCAGCATATCGTCAGCCCCGCCGCAGAAGCTCAAGACGTCGGTGCAGCGATCGTTGCGGCAATCGCTGCTGTCGACGTAT
CCGCTGCTGGCGCCGTATGCCGACGAGCTGCTGCCGAAGAAGGCGTCGCTGCAGTCGATCAAGCTGCCTGATCGTGCGGT
CCTCTACGTGCTCGACCACGAGCCGCTCTTCTTCGAGTCCGGCAAGCCCGGTGACGTCCCGCTGCTGCCGCATCTCCGTC
TCGTCCACCGCTTCCCCCAGGCCTTTCCGAGCATCCGCATCGACCGTGGCGCGATCCGGTACGTTCTCGGCGGCGCCACC
CTCATGGCTCCGGGCCTGACCAGCGCTGGTGGCCGCCTGCCGGCGCCGCAGGAAGGCCAGGCCGACGGCCACGAGGGCGT
CGACGACGAGGGCCGCTGGAGCCGCGAGCTCGAAAAGGGCGAGCCCGTCGTGATTACGGCCGAGGGCAAGCTCGAGGCCT
GCGCCGTCGGTCTGCTCGTGGCTGGCACCAAAGAGGTCAAGGACAAGGGCAAGGGCCCCGTCGTCGAGGACGCGCACTTT
CTCGGCGACGGGCTCTGGCGTCTGGGAATGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62