GenePrediction:GLEAN_1089 Details

Name: GLEAN_1089
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:512610..514303 (+ strand)
Length: 1694
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:512610..512707 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_173:512899..513322 (+ strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_173:513383..513522 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_173:513627..513692 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_173:513762..513970 (+ strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_173:514035..514303 (+ strand)
Length: 269
>GLEAN_1089 class=GenePrediction position=GCSC_173:512610..514303 (+ strand)
ATGCGCGACCTTGTGACGGTTGTACTCTGCTTGCTGCAGCTGTGCCTCGCTGCAAGTGCAGAGTACACGTTGGAAAACGT
CGAAGCTCAAATCGATTCGTACCTCGGCTAGAACCACAACATTACCACGCGATCATCTTCGCTGTGTGGTTGCGATATCG
CTGTATGTATGCAGAGTATCTAGTCTTTGACACTCTTCAATTTACTCATTCTGCTTCGCGCCGTGTGCTTTAGTGTGGGT
TCCTTGCCTTCTCGCGACCTGGTCTCCTCTCGTACCCAGACTCTCCAAGTTACAACCTGCAGGAGCAGTACTGGTCCCAG
CAACAAGCCCTCACACTTTCGGCATGTCGCTTCACTCCTGCTTCAGCAACGGATGTCTCTCTCGCGGTGCTCACTTTACG
CGTCACGTCGTGCCAGTTTGCTGTCAAGAGTGGCGGCCATGCAGCTTTTGCGGGCGCCTCCAACATCGATGCCGGTCTTA
CCATTGACCTTTCCGGTCTGAATGGAATCACAGTGTCTCAGGATCAGTCGCAGACGTCGATAGGTGCTGAAAACCTCTGG
TACGACGTATACACCCATCTCGATCCAATGAACATTACCGTTATCGGTGGTCGAGTGGCCGCAATCGGTGTTGGAGGCCT
GACTCTGGGAGGCGGCATGTCCTTCTTCTCCGGACGGTATGGATGGGCATGCGACAACGTGAACTCATATGAGGTACCTA
TCATTTCTTATCAGTACCCTCCGTCAGAATTGGCCCCATAACTGTTTGGATAGGTTGTACTGGCCGACGGTTCGATCCGC
AGCGTGTCCTACGATTCCGTCTATTCAGACTTATACTGGGCACTTCGTGGCGGTGGAAACAACTTTGGAATCGTGACGAG
CTTCGACTTTGCCACGTATCCCCAAGGCAATCTGTGAGTCTTTGGGTCATTGCCTCCGACTTGCAGTACGGAAAACCCGA
ACCCGATCCGCCAATCCTGCAAAACTTTACGGCGATTCCCGGTGCTGTGTCGGACAGTCTGCGGATCACAAATCTCTCAG
GTCTCACTGTAGAGTTCAATAACTCGAACCCAGGGGGCTACCGGTGCGTACACTCCTTGTTTGCATGTGGTTTGTTCTTC
GTTTTCTCGCTACCGGCTAACAGTCCATGCAGGCAAACGTACTGGACTTTAACCGTCGGGAACAGCGCCGACTTGATGGC
GGATATGGTTGCCATTTTTATGGATGAAGTCGAGCCGTTGAAGGACGTCGTGGGCATTGTTCCGTCTATCATCTTCCAGC
CAATTACCACGGACATGACTACGCACTTTTCCAAAGCCGGCGGTAATCCGTTGGGTCTCGCGGGCCAAGGCCCACTGAAC
TGTAAGCAGGCTTCTTTCTTTGTAGAACCTCCTTGTATGGGACACGTGTTGACTGGACAATTCAGTGATCAATGTTGACA
TTTCATGGTCTGACCCGGCGGACGACGCCCGCGTTCTGGCGGCTGCTCAGAATGCCGTGAGCCGGTCAGCAGCAGCTGCA
AAAGCCCGCGGGCTTACCAACCCATACCTGTACCAGAATTATGCTGCGTTGCAACAAGACGTGTTTGCAAGCTACGGGGC
CGCGAATCTAGCCAGGCTCAAGGCCATTCATGCAAAATACGACCCTCAAAACGTATGGCAAACGTTGCAGCCAGGTTACT
TTAAGCTTGGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62