GenePrediction:GLEAN_108 Details

Name: GLEAN_108
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:733550..737622 (+ strand)
Length: 4073
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:733550..733922 (+ strand)
Length: 373
Type: CDS
Source: GLEAN
Position: GCSC_179:733977..734038 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_179:734114..734960 (+ strand)
Length: 847
Type: CDS
Source: GLEAN
Position: GCSC_179:735047..735943 (+ strand)
Length: 897
Type: CDS
Source: GLEAN
Position: GCSC_179:736008..736012 (+ strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_179:736149..737444 (+ strand)
Length: 1296
Type: CDS
Source: GLEAN
Position: GCSC_179:737512..737622 (+ strand)
Length: 111
>GLEAN_108 class=GenePrediction position=GCSC_179:733550..737622 (+ strand)
ATGGCGGATGAAAGCATTCTTGCCGGCGCTGCCGTCGACACGTTTGAGGATGTGTTTGACGAGGAGGAGCCTCCCAAGGA
GGCTCCTAGCATCCAGCGCATTCGCGCCAACTCCACCATCATGAGGCTGACCAAGATTCTCGTCGCCAACCGAGGCGAGA
TTCCCATCCGCATCTTCAGAACGGCTCACGAGCTTTCGCTCCACACAATCGCCGTCTTCAGCTACGAGGACCGTCTCAGC
ATGCACAGACAGAAGGCCGACGAGGCCTACGTCATTGGAAAGCGCGGCCAGTACACACCCGTGGGAGCTTACCTTGCTGG
CGACGAGATCATCAAGATTGCACTCGAGCACGGCGCGCAGATGATTCACCCGGGTAAGTTGGAGCTTCTCTTCTTTTCGG
TTAGGATTGTCTAACACGTTCTACCAGGCTACGGTTTCCTGTCCGAGAACGCTGACTTTGCCCGCAACGTTGAGAAGGCT
GGCCTCATTGTATGTGCCGAATTCTGGCCGTGACGGCAACCTCTGGCTTTTTCGTGCCCCTCTGACTGATCAACCCTCTG
TTAGTTCGTCGGCCCGAGCCCGACCGTGATCGACGCGCTTGGTGACAAGGTCTCCGCCCGGAGGCTCGCTATCAACGCCA
AAGTCCCCGTTGTTCCCGGAACAGAGGGTGCCGTTGAGACCTTCCAAGAAGTGAAGACGTTCACAGACGAATACGGCTTC
CCCATCATCATCAAGGCTGCCTATGGCGGTGGTGGCCGTGGTATGCGTGTCGTCCGGGACCAGGAGTCGCTTCAGGAGGC
GTTTGAGCGTGCCACCTCCGAGGCAAAGAGTTCCTTTGGTAACGGCACCGTCTTCGTCGAGCGCTTCCTCGACAAGCCGA
AGCACATTGAAGTCCAACTTCTCGGTGACAACCACGGCAACATTGTCCACCTGTACGAGCGTGACTGCTCCGTCCAGCGT
CGCCACCAGAAGGTTGTCGAGATTGCTCCGGCCAAGGATCTTCCGGCAGCTACGCGTGACGCTATTCTTGCCGATGCCGT
CAAACTGGCCAAGTCTGTCAACTACCGTAACGCCGGTACGGCCGAATTCTTGGTCGACCAGCAGAACCGCTACTACTTCA
TCGAGATCAACCCACGGATCCAGGTCGAGCACACCATCACTGAGGAGATCACGGGCATCGATCTTGTTGCCGCCCAGATT
CAAATTGCTGCCGGTGCCTCGCTGCAGCAGCTGGGCCTCACCCAGGACCGCATCTCCACCCGCGGTTTCGCCATTCAGTG
CCGTATCACAACCGAAGACCCGGCTAAGGGCTTCCAGCCTGACACGGGCAAGATCGAGGTCTATCGTTCTGCCGGCGGTA
ACGGCGTGCGTCTCGATGGCGGTAACGGTTTTGCAGGCGCTGTCATTACTCGTACGTTTATCAACGGAGCTTTCTTGCTG
GCATTCACATTAGCTATTATCCCAGTGCTTCCCCTCATATACTGACTCGAACAATAGCCCATTACGACTCCATGCTTACT
AAGCTGTCTTGTCACGGCTCTACCTACGAGATTGCCCGTCGGAAGGTCCTGCGTGCACTGATCGAGTTCAGAATCCGCGG
TGTCAAGACCAACATTCCCTTCCTGGCCTCGCTGCTTACACACCCTGTCTTCATCGACGGCAACTGCTGGACGACCTTTA
TCGATGACACACCCCAGCTGTTTGACCTGGTGGGCAGCCAGAACCGTGCCCAGAAGCTGCTTCTGTATCTGGGTGACGTT
GCCGTCAACGGCAGCAGCATCAAGGGACAGGTTGGCGAGCCCAAGTTCAAGGGAGACATCATCATTCCCGAGCTTCTTGA
CGACAATGGCAAGAAGATTGACGTCAGCGAGCCGTCGACCAAAGGCTGGCGCAAGATCATTCTCGAGCAGGGCCCCAAGG
CCTACGCCAAGGCCGTCCGCGACTACAAGGGCTGCCTCATCATGGACACGACCTGGCGTGACGCCCACCAGTCGCTGCTG
GCAACACGTGTGCGCACGGTTGACCTGTTGAACATTGCCCGTGAGACGAGCCATGCGCTGCACAACCTGTTCAGTCTGGA
GTGCTGGGGTGGTGCCACTTTTGACGTGGCCATGCGCTTCCTGTACGAGGACCCGTGGGACCGGCTGCGCCGCATGCGCA
AGCTCATCCCCAACATCCCCTTCCAGATGCTGCTACGCGGTGCCAACGGCGTGGCCTACTCCTCGCTCCCCGACAACGCC
ATCGACCAGTTCGTTGACCAGGCGAAGAAGAATGGTGTTGATGTCTTCCGCGTGTTCGATGCTCTGAACGATATCAACCA
GCTTGAGGTCGGCATCAAGGCCGTACACAAGGCTGGTGGTGTCGTTGAGGGCACCGTTTGCTTCTCTGGCGATAGTGAGT
CTTTACTATCATTAGCCCTTTCTCCTTAAGATCTATTTTTTTTGCTAATTGTTCACAGTGCTGGTATGTTTGACTCTGCT
TATCATTTTCTTGCGTGTCTGAAATTTGGCACAGCCCAAAATTGCCGAACAAAGACATTGACGCTATGCATATACCCTTT
AAACGCATACCCTATATGCAATTACTGACACCTTCACAGAATCCCACGAAGAAGTACAACCTGCCGTATTACCTCGAACT
GGTCGACAAGCTTGTTGCCCTTGACATTCATATCCTGGGTATCAAGGACATGGCTGGTGTGCTCAAGCCGCATGCAGCCC
GTCTTCTGATCGGCTCCATTCGCAAGAAGTACCCCGATCTTCCCATCCACGTGCACACGCACGACTCTGCGGGCACGGGT
GTGGCTTCAATGGTCGCATGTGCCGAGGCAGGTGCCGATGCGGTTGATGCTGCCACGGACAGCCTGTCAGGAATGACCTC
TCAGCCGAGCATCAACGCCATTCTCGCCTCTCTCGAGGGTACCAACCTCGACCCTGGTCTCGATGTGCGCCACGTGCGCG
CATTGGACACATACTGGGCACAGCTCCGCCTCTTGTACTCGCCGTTCGAGGCCCACCTTACGGGTCCGGATCCGGAGGTG
TACGAGCACGAGATTCCTGGTGGTCAGCTCACGAATATGATGTTCCAGGCGTCGCAGCTCGGCCTTGGTTCGCAGTGGGC
CGAGACCAAGAAGGCTTACGAGCACGCCAACGATCTTCTTGGCGACATTGTCAAGGTCACGCCAACATCCAAGGTGGTTG
GTGATCTGGCACAGTTCATGGTGTCCAACAAGCTGAGCGCGGAAGACGTCAAGGCGCGCGCTGGCGAGCTCGACTTCCCT
GGATCTGTTCTGGAATTCTTCGAGGGTCTGATGGGCCAGCCGTACGGCGGGTTCCCGGAGCCGCTGCGCACGAACGCACT
CCGCGGCCGTCGCAAGCTGGACAAGCGTCCAGGCCTGTTCCTGGAGCCGGTCGACTTTGCCAAGGTCCGGAAGGAGCTGG
CTAAGAAGTATGGTGCGCCAGTGACGGATTCAGATGTGGCTTCGTACGTCATGTACCCGAAGGTGTTCGAGGACTACAAG
AAGTTTGTGACGCGGTATGGCGATCTGTCAGTGCTGCCGACCAAGTACTTCCTGTCGAAGCCGTTGATCGGCGAGGAGTT
CCACGTGGAGCTGGAGCGCGGCAAGGTTCTGATCCTCAAGCTGCTGGCAGTTGGCCCGCTGTCGGAGAACACGGGCCAGC
GCGAGGTGTTTTACGAGATGAACGGCGAGGTGCGCCAGGTGACGGTGGACGACAAACAGGCGTCGGTAGAGAATGTCAGC
CGGCTCAAGGCCGACCCGACGGACAGCAGCCAGGTCGGCGCGCCGATGGCCGGTGTGCTCGTCGAGCTGCGCGTGCACGA
CGGCAGCGACGTCAAGAAAGGCGATCCACTTGCTGTTCTGAGCGCCATGAAGATGGTATGTGTTTCTCTGACAATCTCCC
ATTTCCTCTTGCATGCGATGTGTCTTGCTAACTGGCTCCCAGGAAATGGTTATTTCTGCCCCACATGCCGGTATTGTGTC
GCAGTTGATAGTGAAAGAGGGTGACTCGGTTGACGGCTCAGACTTGGTCTGCCGGATAACCAAGAAGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62