GenePrediction:GLEAN_1090 Details

Name: GLEAN_1090
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:515634..517156 (+ strand)
Length: 1523
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:515634..515769 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_173:515825..515954 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_173:516033..516098 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_173:516522..516870 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_173:516920..517156 (+ strand)
Length: 237
>GLEAN_1090 class=GenePrediction position=GCSC_173:515634..517156 (+ strand)
ATGACTGACCCCCAAGCCAGGACGGGCAATGCTTTCCCAGCTGCTCCTCCGGCTTCCCCTCCGCATTCCACTTCAACCAC
AGAACCCCTGATTCAATTCCAGTCCCCGCAAGTCTGGACCGAACTGAACGTTTCGGGTATTGCTCTCCATCATTGGCACA
CCCAATAGATACGCGCTGACACTCTCTCTAGAAGATGACGACGACTCGGCCCTCGGCGACGACAGTGCGAGCTCCACGGA
GTCTTTGGCGTCTAGCATCCGGAAATATCGCGTTCTGAACGGGCGCACGTATCACCATAACCAAGACGAGACGCACTACT
GGTATGCAGATAGCAGACAGCCGACGGCAGCGGCGGGTGGTTCATTGGAAATCATTTTATTTTCTAACGAATTGCATAGG
GGCCCTAATGACGACCGACAGAACAATACGCTCGATCTTGGGTCAGGACGGGCACTGTTAAGCATGTATGCACAGACTAC
GGCAGCTGACTTGATACAGACATCACTCTTACACGCTCCTTCAGGGAGGCAAGCTTTATCTTGCGCCTTTGCCAGAACAT
GTCGATGTAGGCCAGAACCTCCCAGTTAACAGCTTCCATGCGATTTTAGCCTAACAAAAGCAATGCAGAAAGTGATTGAC
ATCGGCACTGGAACTGGTATCTGGGCTATGTTTGTAGTTCTTTTTCGTTTGTCTGAAGTTTGCCGTTTATGCATTAACCA
TATCTACGAAACCAGCGATTTCGCAGACGAACGTCCGGACACCACGGTGGTCGGTACTGATATTACCCCCATTCAACCAG
ATTGGGTACCACCGAATCTATACTTGTATATTCATACCTTTTTTTTTCCCATCTTGTACAAGTAAATCCTGTGCTAATCC
CGTCCTAGCCAAATGGACGACTTCACAAAGCCATGGATGTTTGACGACAACTCATTTGACTATGTGCACTTGCGCTGGCT
TGTTGGCAGCGTAGAGAACTGGACGGATCTGTTCAAGGAGGCGTACAGAGTCCTGAAGCCAGGCGGGTACATTGAGACCT
TCGACCTTGACGGCAACATTACCTCGGACGACGGCACTGTAACCGAAAAGACGGCCATCTCTCAATGGGGTTTTATCTTC
CAGGAAGGCGCCCGGAAGCTTGGTTCGCGCGCCTCTTACAACCCGATCGGAGAAGGTCTGCAGCACCGAGCTCTTGTTGA
TGCAGGCTTTGCCAACATTACCGAGAAGCCGTTCAAGGTAAGATAAACCGCTTACGTAATGCGGCACTGAAAACTGATAT
AACCAGCTTCCAACCTCTGAATGGCATGATGACCCGATCCTGCACGAGGCTGGCCAGTTCAGTCGTGCGACTATCATGAA
CGATATTGAGGGATTTATAGGCATGATGGCCACCCAACTCGGCTGGACTACGGAAGAGATATCTGTGTACTCCGCCCACC
TGCGCCGAGAATTGCGGAGTCTGAAGATACACGCCTACTTTAACGTCTGCGCAGCTTACGCCCAGAAGCCTGTGGACGTG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62