GenePrediction:GLEAN_1091 Details

Name: GLEAN_1091
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:521934..523561 (+ strand)
Length: 1628
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:521934..522259 (+ strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_173:522310..523561 (+ strand)
Length: 1252
>GLEAN_1091 class=GenePrediction position=GCSC_173:521934..523561 (+ strand)
ATGTCTGTCCTTGGGCTCTTGTACAGCTACTCCGCCTGGAGTCCAGCCGTGCTGGCCGTGCTGGCCGTGCTGACACCGCT
GGTCTACTATTTCTACCCCTATCTCTTCACATATGCAGCTCTGCGATCGCTGCCTGCACCGTTCCCAGCCCAGTTTACCA
ACTGGTGGCTGCTGTCTGTCTGTCGGCGCGGCAATCGCTACCTTGTCGTCGACGACCTGCACAAGAAGCTCGGTCCCGTT
GTGCGCATTCAGCCCAACCACGTGAGCATCAACGACGATGCGGCCATCAACACCATCTACGGCCACGGCAACGGCTTTCT
CAAGAGGTGAGTTTTTCTTCTTTTCATTTCTTCTTTTTCGCCTCGCTGACAGTCAGTGACTACTATGACGCCTTTGTGAG
CATCCAGCGCGGCCTATTCAACACGCGTGACCGCGCCCAGCACACGCGCAAGCGCAAGATTGTCGCGCACACCTTCTCGC
CCAAGTCGGTCACACAGTTCGAGCCCTTTATCCACCACAACCTCGAGCTCTTTGTGCAGCAATGGGACCGGATGATCGCC
GAGGGCACGGGCAGCACGGGTGCGGGCGCGGCTACGCTGGACTGCCTCAACTGGTTCAACTATTTGGCTTTTGACGTGAT
CGGCGACCTGGCTTTTGGTGCGCCCTTTGGTATGCTCTCGAGCGGCGCCGATATTGCCGAGGTGCGGGCCTCGGCCGACA
GCCCACCGGTGTACGCGTCCGCGATTGAGATTCTGAACCGGCGCGGCGAGGTCTCGGCGGCGATTGGGATTCTGCCGGCC
CTGAAGCCGTGGGCCTCCTGGATGCCGGACCCGTTCTTCCGCAACGGGTCCAAGTCTGTCCAGCAGCTGGCCGGGATTGC
TATCGCCCGCGTGCGCGAGCGTCTGGAGCGCCAGCCGTATGGCAAGGACCTCGAGAACGGCCGGAAGGATCTGCTGGCCC
GTCTGATGGAGGGCCGCGACGACAACGGCGCCCCGCTCGGCCGCGAGGAGCTCACGGCCGAGGCTCTGACCCAGCTGATC
GCCGGCAGCGACACCACCTCCAACTCGTCGTGTGCCCTGCTCTTCCACGTCGTCCGCACCGACGGCGGCCGCGTGCTGCG
CCGCCTGCAGGCCGAGCTCGATGCCGCTCTGCCGGCCGGCAAGGACGTGCCCACCTTTGACGACGTCCGCAACCTGCCCT
ATCTCCAGTCCGTCCTCAACGAGACCCTGCGCCACCACTCCACCTCTGGCATCGGTCTGCCGCGCCAGATCCCCGCCGAT
AGCGCCGGCATCACCCTGCACGGTCACTACTTCCCGCCCGGCACCGTGCTCAGCATCCCGACGTACTCGATCCACCACTC
GACCGACATCTGGGGCCCCGACGCCAACGAGTTCCGGCCCGAGCGCTGGGAGAACGTGACGACGCGCCAGCGCAACGCCT
TCATCCCCTTCAGCCACGGCCCGCGCGCTTGTGTCGGCCGCAACGTCGCTGAGATGGAGATGAAGCTCATCATCGCCACC
TGGGCCCGTCGCTACGATGTCCGCCTGCTGCAGGACTACCTCGGCACCAGCGAGGGCTTCTTGCGCAAGCCGCTGGGCCT
CGACATCGAAATCCGGAGGCGGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62