GenePrediction:GLEAN_1092 Details

Name: GLEAN_1092
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:524079..524890 (+ strand)
Length: 812
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:524079..524141 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_173:524249..524890 (+ strand)
Length: 642
>GLEAN_1092 class=GenePrediction position=GCSC_173:524079..524890 (+ strand)
ATGGGTTCTCGAGGCATCACCGTCCTCAAATTTGTCGGGACTGTCTCCCTCGGTTTACTGACTGTGAGTAACGTGGTTTT
GGTCGTGTCCTGTCTCTTTTTTTGTCTGCTGTCTGCCACCTGCTGTCTGCTCTCCTTTATCCTAGCCTCTCCCTGCTAAC
AGCTTCGCAGGGCCTCTCCTTCTCTCTGTCTACCGTTACCGTTCCCACCCTTCTGACGCTGCCTTCCGCCCGAACGGCCT
CCAAGGCATTCTTGAGCCTCTCTGACGCTGCTTCCTCCCATCTGCGCTCCCTCTCTGGCATCGCCACCTCGGCCTTTCTG
CTCGCTTTCCTGCTGTCTCCCCGCCATATCCGCCATCCGTACCTGCTGTACACCTCCCTGCTCGTCCTCAGCGGCCGGCT
GGTTACGGATGACCGTCTGACACCCTACATCTTCTCTACTCCGACTGCTGCTAGTGCTGCTGTCGCTTCGTCGCCGCTTG
TCAAGCCCGCCAAACACCGCAGTACGCCGGCACACATGGAGGCCAGCTACGAGGTGCTGGGCGCCCACACCACCGGCTCC
GTGGCCGGCTCTGTGGCCGGCTCTGTGTCCGATTCACACAGCGACGGTGCCATGTCGGACGGCGAGCTGCCCGCCACTGC
CGCCTCGACAACGGCCTCGGCCACGGCAGACAGCGCTGTCAACGGCGAGGAGGTGCGTGCTGACGTCGAGGTCTTCCTCA
AGAAGCAGATCGCACGCACCGTGATCAGCGGCCTGGCCTTTTCTATTGCTGTTATCGGCATCTGGGGCGACGGGTTGCTC
CCGGCTGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62