GenePrediction:GLEAN_1093 Details

Name: GLEAN_1093
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:526264..528092 (+ strand)
Length: 1829
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:526264..526985 (+ strand)
Length: 722
Type: CDS
Source: GLEAN
Position: GCSC_173:527040..527730 (+ strand)
Length: 691
Type: CDS
Source: GLEAN
Position: GCSC_173:527810..527915 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_173:527968..528092 (+ strand)
Length: 125
>GLEAN_1093 class=GenePrediction position=GCSC_173:526264..528092 (+ strand)
ATGAGCTCTGCCAAGCCGCCCAAGTCCTGGCAGGAGGCCCGAGACGCAAAGAGGGCGGAACAGCTGTTGCGCATCCCGGT
GGAATGGAGGCTGAGCGAAGCCAATCGGCCGGCGGCGGACACATCGGACCTGCGGCCGGCGGCAGCGTCGTCGGGGATCC
TGAGCGAGCGTGAGCTAGCAATCACTGGCGACGGGCACGACGCGACGTCGCTGGTTGCGGCGATTGCACAGGGCACGTAC
ACGGCGACGGAAACGGTGACAGCATTCTGCAAGCGGGCAGCCATCAGCCAGCAGCTGTGCCGGTCGCTGACGGAGATCTG
CTTTGCCGAGGCGCTGGCCAAGGCGGCGAAGCTGGACGCGCACTTCCAGGCGACCGGCCAGACGGTCGGGCCGCTGCACG
GGCTCGCCATGACGTTCAAGGAGTGCTTCCACATCGAGGGCTTCGATGCCTGCAACGGCTACGTGGCACGCATCGGTGAG
CCGTCGACGACGACGACGCCCATCATCCGGCTGGCCGAGCAGGCCGGGGCGGTGCTGATCGCCAAGACCAACGTGCCGCA
GACGATGCTGGTGGCCGAGTGCGACAACAACGTGTTTGGCCAGACGCGGAACCCGGTCGTGAGCCAGCTCTCGAGCGGTG
GCAGCAGCGGCGGCGAGGGCTCGCTGTCGGCCTTTCGGGGAAACGCCTTTGGCGTCGGCACCGACGTCGCTGGGTCCATC
CGGTAGGTGCTGCTCTGCCTTGCTGCTCTCTACGCTTCTCTCCCCTGACGTGACAGACTGCCAGCTGCCTTCAATGGCGT
GTACGGCTACAAGCCATCAGTAGGGATCCTCCCGTTCATCGGATATGCAGCGTCGGGATGGACGGGCGTGAACACGGGCG
TACCGGCAGTGCTGGGCCCCATTGGCCGCTCCGTCCGCGACCTGGCCCTGTTTACGGACACGATCCGCGCGCGAAAGCCC
TGGACGATCGACCCGGCCATCATTCCCGGCGTCATGGAGCAGCCGGCACCTACAAAGAAACCGGTGGTGGGGATCTTGTA
CGAGTCGGGCCTCACGCCACATCCACCGGTGCAACGAGCGATCCGCGAGGCCCAGACCAAGTTGGAAGCAGCCGGATTTG
AAACCAGGGATTTTACACCGATGTGTCCTGACTTCAAGGAGATGCGCGACATCTCGGCCGACCTCTTGACCGTCGACGGA
CTCTCGTACCAGCGGCAGAAGCTGGCCGAGTCTGGCGAGCCGGCCGTTCCGTCGGTGGCCGGCTTCGGCTACTGGGACCT
GAAGCGGAAGACGCACGAGCAAATGTGGGCGCTCAACACGCGCAAGGGCGAGCTGCAGAAGCAGATGCTGGACGCCTGGC
AAGCCGCGGGCATCGACATGCTGATCGCCCCGGCCGCACCGCACGTCGCCATCCCGCCACCCCACATGACATCGGAGCTG
TATACGGTGGCCTGGAACGTCGTAGATGTGGGTGTGAAAATGGGCAGAGACAGCAGGGAGAGTATACGGAATATATGCTG
CTCAAATGCTGACTAACATTAACTAGTACCCAGCCATCATTATACCGTTCGCCACAGTGGACCCTGCCTTGGACAAGAGG
GACGGCGAGTTCAAGCCCAAGAACGAGCTGGATGCAGAGATTGCAGCTTATTGTAAGTACATGTGACTTGTCTGCTGCTC
TTGCTCTTCTGCTGACGTCTGTAGTCGACCCGGAGCTCATGGCCGGTGCTCCCGTGTCGCTGCAGCTTGTCGGCATGCGG
CTCCACGACCGCGCGCTACTTGCACACGCAGAGATGATCGACGGAGTTCTTAACGAAGCCAAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62