GenePrediction:GLEAN_1095 Details

Name: GLEAN_1095
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:540480..542850 (+ strand)
Length: 2371
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:540480..540510 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_173:540707..540717 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_173:540811..540902 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_173:540978..540998 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_173:541200..541213 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_173:541282..541785 (+ strand)
Length: 504
Type: CDS
Source: GLEAN
Position: GCSC_173:541844..541943 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_173:542001..542028 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_173:542085..542168 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_173:542217..542292 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_173:542348..542374 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_173:542434..542666 (+ strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_173:542797..542850 (+ strand)
Length: 54
>GLEAN_1095 class=GenePrediction position=GCSC_173:540480..542850 (+ strand)
ATGGCAAGCATCATTTTGGGCTCCCAATGGGGTGAGTTTACCTTTTGCTACCCCCCTTGCTGGTGCCGCATCCTTCTAGC
GCTTGGGCCGAGAAATTGAGCAAGCCACGGTCAAAGACGAGGGCAAGATGCGCGAAACCCTCTTTCTACGATCACCGATA
TCAAAAGCGCCCACCCAGCCCTCGACTTAAAATATGTGCTGACACTGCCTCTTGCTTTGTATTTTAGGAGACGAGGGCGT
ATGTATTCCGTTCCACAGTCAAACTTCCGAACAAACGGTGCCACACCAACATTTCTAACCATTGCATCGAATATCCCTCC
TCACGAAACAGAAGGGCAAACTGACGGACCACCTCCTCTCGACCGATGCGTACGACATCTGCGCCCGTGCCGCCGGCGGC
CACAATGCGGGCCACTCGATCAAGTAAGCGACCACCTGGACGCAGGACCTGTGTGTGCTTTGCGCATACCAACATGACTC
ATTTTACTGACTATCCAGAACGGGAGGCCAGAGCTTCAGGTAGATTTTTCTCTTGTCAACGGAGGCAGCAGCTGTGTTCG
TCCATCCCTCCGTGCGAAGGAGAGTACAAGCTTCTGCTGCCTCCGCCCCCCCCTGCGTTTTTTGTTTCTTTTTCCTTGCC
TTGCCCTGCAAGGCTGTGAGTCTAAGTAGTATATTTGGCCCCATGGCTGTGTGGCTGACCGAAGATGTTGTGTAATGCAG
TTTTCACCTGTTGCGTGAGTGTTATCTGTCTCTCTGTCCCCTATCTCACTGTTCGCTAACCTGGCCCCGTTGGGGAGCAC
AGCGTCAGGTCTGGTGAACCCAAAGACGGATAATTTGATCGGATCGAGCGTGGTGTTCAACCTCGAGGCATTTTTCAAGG
AGCTGTCAGAGCTCGAGGCCAAGGGCGTGCCCAACGTGCACGAGCGCATCCACGTCAGCTCGCGGTGCCACCTCAACTTT
GCTCTGCACGCCGCCGTCGACGGCTTGTCAGAGGTGCAGCTGGGCAATGCGATGATCGGCACGACCAAGCGCGGCATCGG
CCCGTCCTACAGTACCAAGGCGTCGCGCGACGGCCTGCGCGTCATCGACCTCTACAGCGATTCGTTTGAGCGCAAGCTGC
GCAAGCTGGCCGGCGAGTACCGCCAACGCTACGGCGACCTGCTGCAGTACGACGTCGAGGCCGAGCTGCGCCTCTACGCC
GAGTCCAAAGACCGGCTGCGGCCCTACATTGTCGACGCCGTCGAGTACATGCGCAACGCCCAGGAGACCCATAAGAAGGT
CCTTGTCGAAGGCTCGCAGGCCCTGAGTACGGTTTTGGTTTTGCTTGTCATGTTTGTCTTTCGATCGTCCAACTGACCTT
GCAGTGCTCGATATTGACTACGGCACGTATCCCTACGTGACATCGTCCAACACCGGCCTCGGTGGCTGTATCCAGGGCCT
CACGCTCAACCCCACCTTTATCAAGTGCGTGTATAACACTGCTAGCTCTCGCCATATGTGTCAATGTTGACCATCTTTCA
GAGACGTGATTGCTGTCACGAAGGCTTACGTAAGCACACTTTTTACCCATAGTATGAGAAAGCAAGCTGACACAGATAAC
AACAGACAACACGAGTTGGCGGCGGTCCGTTCCCGACGGAGCAGCTGAACGAGGTTGGCACTAAGCTTCAGGACATCGGT
GGCGAGATTGTAAGATGCCACAAGAGCTGTACTTTACGACTGAGCTAACGCAATCAGGGTGTCTCGACTGGTCGCCGGAG
ACGATGCGGCTGGCTGGACCTTGTGGTTCTCAAGTATTCGACTGCGGTGAACCGTACGCAAGACAACTTTCTCATAGCTG
GGCATCTGCTGACTAACAACGATTGCAGACTACACCATGATTAACCTGACTAAGTGTACGTTGCTCGTGATGCTTGTCCC
CCTCAGTTCCCCTCTGAGACTAACGTTGTCGCAGTGGATGTGCTGGACACATTCCCGATCATCCGCGTGGCCACGGCCTA
CATCACGCCCGAGGGCGAGAAGGTCACGACCTTCCCTGCCGACCTCAACGAGCTGGAAAAGTACACGGTCGAGTACGTCG
ACTTTGAAGGCTGGCAGACGTCGACAAAAGGCCTGCGGTCGTGGGACGAGCTCCCATCGAAGGCAAAGAAGTATATTGCG
CTGATCGAGTCGTTTATCGGCGTCAAGGTATGATTCCTTTACGGGCTGGCAGATGCTGTACCCCCTTTTCTTCCTTTTCT
TTTCCCCTCTTCCCCTCTTCCCCTCCGCTCGTCCTCCTTCTCCAACCCCTCCCCCCTTCACACACTAACAAGGACAGGTG
GTCTATGTGGGAACAGGGCAGGACCGCGAAGACATGATCATCCGGTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62