GenePrediction:GLEAN_1096 Details

Name: GLEAN_1096
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:543401..545000 (+ strand)
Length: 1600
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:543401..544199 (+ strand)
Length: 799
Type: CDS
Source: GLEAN
Position: GCSC_173:544260..544686 (+ strand)
Length: 427
Type: CDS
Source: GLEAN
Position: GCSC_173:544784..545000 (+ strand)
Length: 217
>GLEAN_1096 class=GenePrediction position=GCSC_173:543401..545000 (+ strand)
ATGGCAACGAGCTTTGCAGCAGGCGCAGACGAGGATGTCACGACGGCTAGTCTGACGAGGTCAGCGCAGTCGTCGAGCTG
TTCGTCATCGACGTCGTCGTCGGCAGCGTCGGTCTCGGCGACGTCGCCGCTTTTCGCGCGGGCGCCGACGATCGTGGCGC
ACGAGCTGCAGCGGCTGACGCGACAGCGCCGGCGGTTTGCCGAGTTTGAGGCCGGCTTGCCGGAGATGCTGTCACAGGCG
AGTGAGAAAGTACGGACGATTTCGGGAAGTCCAGGGGACTTGGGGGGTGTGGATGGTGCTGGGAGTCCGGGCAGTCCTCT
GCCGGTGACAGACAAGGACAGTGTCTGGCTGTTAGACAATGTAGCCTACCGAGAGGCGGACACGACGACGACGACTCCTG
GCTGGCGGGCAGAGTATGTGGTGGCTGTGCTGGCGCAGCAGCTGGCTGGCCCGGTCGGCGGCACGGTGGCGGCGGTGCAG
GCGGTGGCAGAGCGGTTGGGACGTGGCGGCAGCGGGCCGGTGGACGAGGCCACGCTGCAGACGATCCGGCGGCGGATGCG
GCCGTTTCTGCAGGCAGTGCTGCCGGGCCGACAGGTGCGGGCGCGCGTGGGCGACGACTGGCCGCTGGTGCTGAGCCCGA
GCGACAGCGACGGCGTCAGCAGCGACGTACAGCGTCTGCCAGACAGCACGCGGGCCGGTGCTTTGGTGTCGACGACGGCG
GAGGTACCAGCCGGCACGGACGGCGAGCTGTCGATGCAGACGCTGTTTGCGGAGGGGACTGGCTGGGGGGTGATATCCGG
TAGGTTGAAGGCGACATGCTGGCGCGAAAAGAAGAGGCAGAAATGAGGCTGACCGGCAGACATCGACGACACGATCAAGC
GCACGCAGACGAGTGATCCGGTCGGCATCCTGCAGACGACGTTTGTCGACGAACCCGAGGCCATTGCCGGGATGCCGGAG
CTGTACCGGTTTCTGGCCGAGGTCACGGCGCCGGCCGCGTCGGACGGCGGCAGCGCGGCGATGACGCCGTTCTTCTACCT
CTCGGCGTCGCCGTACAACCTGTACCCGTTTCTGCGACGATTCCGCCAGCAGCACTACCCGCACGGGGCGCTGCTGCTGC
GCGACGACTCGTCCATGAGCGTGGCCGGCCTGCTGCGGACGCTGACGCTCGACACGCGGGACTACAAAGTGCAGCGCATC
GCCAAGGTGCACGGCTGGCTGCCACAGAAGACGATGTTGTGCATTGGCGACAGCACGCAGAGCGATCCAGAGGCGTACGG
AGAGATGTGAGTTGGTGTTTGTTTCTTTTTCTTTTTCTTTCGGATTGTTTTTCCTTTTGTTTTCCTTTCTTTTTTCTTCT
ATTTCCCACCTCTAACTTCCCAGCTACCGCTCCTTCCCCGGCTGGGTCAAATTGATCCTCATCCGCAAGGTGGCCGACAT
TGCGGCGGTCGGCCTGGCTGAGAAGAATGAGCCGGCACGCTTCGAAAAGGCGTTCCATGACATGCCTACGTCTGCATGGC
ACGTATTCGAAGACCCAGCCGAGTGCTATGCACACGTGCAGCGGGTGATCGGCGGAGAAATCCCCGAGACGGAAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62