GenePrediction:GLEAN_1097 Details

Name: GLEAN_1097
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:545635..546213 (+ strand)
Length: 579
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:545635..545842 (+ strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_173:545898..546139 (+ strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_173:546196..546213 (+ strand)
Length: 18
>GLEAN_1097 class=GenePrediction position=GCSC_173:545635..546213 (+ strand)
ATGCTCGTAAAGGTCTTTGTTGCCGCCATCACGCTGGTGTCGGCTGTCACCGGCTCCTGCGCCGCACCTCCGCCGGCGCC
GACGCTGAGCTTCCTGTACAGCCTCAACCTGACGAACGGGGCCGAGTACGCGATCGGCGCCACGCCGCAGGGTTTCCGCA
CCGTGCAGCCGATCGTAGGCGGCGCCTTTTCCGGCCCCAAGATGAAAGGTACGACCAGAGGGGAGGCAGGAGGACAATAT
GGTGGCCAATGCTGATTCGACAGGCAATGTCACGACCGGCATCGACTACGGCGTCGTCGACAGCAACAACACGTTCCACC
CCAAGGCCGTCTACGTGCTCGAGACGGTCGAGGGCGACACCATCCTGGTGACCGAGAGCGGCCGGGCGCCCAACATCAAC
GTAATCTTCGACACGGCCAGCACCAAGTACGGCTGGCTGAACAAGGCGGTCGGCTACGCCACCGGCGGCCTGGTCGACGG
GGTGGTATCGCTGAACGTGTGGCAGGTACGTGATTTTATTGTTGTTTTTGTTATTGTTTGTTTAACTCTGACCAATAACA
GATCACTCCTCCCTCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62