GenePrediction:GLEAN_109 Details

Name: GLEAN_109
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:738636..739548 (+ strand)
Length: 913
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:738636..738666 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_179:738727..738780 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_179:738842..739548 (+ strand)
Length: 707
>GLEAN_109 class=GenePrediction position=GCSC_179:738636..739548 (+ strand)
ATGATCAAGTTTAATATGGGACTGAACAGGCGTGAGTGCCGGACGCCCTCCCTTCTCTCTCTACTAAGGACCCCCTGCTG
ACTCTCCACAGGCATGCGTCAGTATTTTATCTGCCTTGTTGCCATCATTGTCGTCATTCTCTACGGTGCGTTTTCTCTCT
GTTGCCGAGTCTGCCGTAGCCCTGTCTGCTGACCGTTCGTTCCCAGTCCTCGCCCTCACCGGCTGTCTTGGCACCTCGCC
AGGCATTCCGGGCATCTATCTGGTCCGGTACTTCAACAACGTGACCGAGGCCGAGGTGCGTGTCGGCCTGTTCGGTCTCT
GTGCCGGAACGGCCGGAAACCTGACCTGCGCCGCCACCATCGGCCACAACGGCACCGTCGCCAACACGATCGCGTCGGGC
TACACGCTGCCCGGCTCGGCGGCCAACACGGCTGCCCCGTCTGACCTGCAGGCGATGCTCGCGCTGGCCACCACCATGCA
GGGAAGCACGGCCACCGGCCAAACCGTCGTCTCGGCCGTCTTCGTCCCGCTCATCGTCGGCTGCGTCTTTTTCGTCACGG
CCGTCTGCGCCCTGCTCGCACACGGCGCCCTCAACGAGCCCAAGTTTGTCGAGGAGGACGGCGCCTGCTACGAGTCTGTG
CATCGCACGCGAGCCTGGCAGGTTGTCGGCGTTGTCACTACGTACTCGGTGGCCGCGTCGCTGGCCGCCGCCATCGCGAC
CACTGCCGCCGGCCGCGCGCTCCTCTTTGCTGGCTCGGCGCTGCCCGGCGCTGCGCTCACAGCCGCCCAGGCTGCTAGCC
GAGACACTATCCAGGCACAGACCGGCACGGCCCTGCCGGTGCTGCAGTGGCTGGTGGTGACGCTCACGCTAATGTGGCAC
CTGCTGATGACGTTTGTGTGGCGGAAGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62