GenePrediction:GLEAN_1101 Details

Name: GLEAN_1101
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:564900..566059 (+ strand)
Length: 1160
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:564900..565031 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_173:565133..566059 (+ strand)
Length: 927
>GLEAN_1101 class=GenePrediction position=GCSC_173:564900..566059 (+ strand)
ATGGTGCAACTGGTCAGCGCCCCGAGCAACCTGCCGGATCTCGTCCGCACGGCCTTTGCCCGTGCCCGAGCTGCCGGCGA
CCTCACCTTCTTCCCCACGCAAGTGGCCCTCCTACGCATCAATGGCATTCCGGTACGATAGACCCCTGCATATTTTTTCT
GTCTGGTTATCTGTCTGTCCGTCGTCTGATTTGCTTTTTCTTCTTTTCCCCCTTGCCTTCTTGCTGCGTGCAGCTCCAGC
TCCGCTTCGCCCCGTCTCTGGCCAAGAAGCCCAAGACAGCAGACGCCAGCAAGAGCGCCAGCCATTCTGGACCGACATCG
GTGCGTCCGTCGTTCGACCCCTTCGAAAACCCTCCGCCCGGTCTCCTGGTGCTGTCGCAGATCGGGCCCGCCCACCGCCT
CGTGCTCAACAAGTTTGCCATCTGCCGGGACCACGCTATCCTGGCAACGGTCGACTTTCGGCCGCAGAGCCACCTGCTGG
CTGGCGACGATCTGGCTGCAGCGTATGCCTGCATCGAGGCGTATCATGACCAGGGCCAGGAGCTGTTTGTCTTTTACAAC
AGTGGCGCCCACTCCGGGGCCAGCCAGCCGCACCGACACCTGCAGATGCTGCCTGTGGCATGCATGCGCGAGGGCCTGAG
CGAGGACGGCAGCGGCAGTGATGCGTCTGTCTGGGGCGTCGCAGTCGATCAGCTCACAAGACAGACAGCAGCATCGACAA
GGCCGGCAGAGCTTCCCTTTCACGTGGCTACAACCCCCATACATCGGGATGAGGCCTCCCCGTCTGCCGAGTTGCTGCAC
GCCCTGTATCTGCGCCTGTACCGACAGGCATGTGTCGCTGCTGGCCTGTCAGCACAGGACGGGATGGCCGAGGAGCAAGG
CCAGGTGCCTGCTCGCCTGAGCTACAATCTGGCCCTCACGCAAAAGACAATGGCACTGTGTCCGCGCACGGCCGAGGGCA
GTGCTGTCACCTCGTCCGACGGAACCAGCGTCGGCACGCTCTCACTGAACGGTACCGTACTGGCTGGCACGGCGCTGGTC
AAGAACGAGACCGAGTGGTCGGCCCTGCGCCAGGATCCCGGCCAGTTGACTCGCATCCTGCGCCAGATCGGTCTGCCCGC
CGGGAGCGTGTCGTCGTCTAAAGAAGGGTCCGCATCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62