GenePrediction:GLEAN_1102 Details

Name: GLEAN_1102
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:578415..580152 (+ strand)
Length: 1738
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:578415..579900 (+ strand)
Length: 1486
Type: CDS
Source: GLEAN
Position: GCSC_173:579953..580152 (+ strand)
Length: 200
>GLEAN_1102 class=GenePrediction position=GCSC_173:578415..580152 (+ strand)
ATGCCCCTTGTCCGCAACCCGATCCTGCCCGGCTTTCATGCGGACCCGTCGGTGGTCCGGGTCGGGGCCGACTACTACAT
CGCGACATCGACGTTTGAGTGGTTCCCGGGCGTGCAGATCCACCACTCGACGGACCTGGCCAACTGGACGCTGGTGGCAC
GACCTCTGCAGCGGGCATCGCAGCTGGACCTGCGCGGTCGTCCCGACAGCGGCGGCGTGTGGGCGCCGGACCTCTCGCAC
GACGGCACGTCTTTCTGGCTCGTCTTCTCGGACATGCGGCGCCGTGCCGGCAGCTTCAAAGACGTGCACAACTACGTGGT
GCGGGCACCGACGATCGCAGGCCCCTGGACCGACCCAGTGCATGTGGGCTCGTCTGGCTTCGACCCGTCCGTCTTCCACG
ACCCCGTCGACGGTCGGACCTGGCTGGCCAACATGCTGTGGGACCACCGACGCCGACACCACGGCACAGCCTTTGGCGGC
ATCGCGCTGCAGCAGCTGGAGCTGGACCCCGACGGCAACCACTGCCGGCTCGTGGGACCCCGGCGGACCATCTTCCGTGG
CTCGCCCCTGCGTCTGACCGAGGCGCCGCATCTCTACCGCCGCGGCGAGTTCTACTATCTGCTCACGGCCGAGGGCGGCA
CCGGCTACCACCATGCCGTCACCGTGGCACGAGCCCGCGACCTCGCCGGCCCTTATGAGCTGCACCCGCTGCGTCACCTG
CTCACGAGCAAGGACCATCCGCGCGCAGCACTGCAGCGAGCTGGTCACGGCGACCTCGTCGACACGCCCGACGGTAGCCG
CTCCTTTCTCGTCCACCTGGCCGCCCGGCCGACGACACAGGAGCGTCGCTGCGTGCTCGGTCGCGAGACCGCCATCCAGT
CCGTCCGATGGGCCGACGACGGCTGGCCCTACGTTGACAGTGGCCCCGTGCCGTCGCTGCTGGTCGACCTGCCCGGCCAC
CGCGATGATAACCCGGCCACGTCGCCGTACTGGGCCGAGCGACGCTACACGTTTGGCGACGAGACCGAAGCGACGACCAA
TGGCCCCGCGGCCCGGCTGCTGCACCCCGACTTCCAGTGGCTGCGCACGCCCGAGCCTGAGCGCATCTTTGCCGTCCAAC
AGGACCGGCTCACCCTCTTCGGCCGCGAGTCCGTTGGCTCCTGGTTCGAACAGGCCCTCGTGGCGTGCCGCCAGGAACAC
TTCTCGTTTGATGCCGAGACGGCCGTCGAGGTCGCACCCACGGATGAGCGCCAGTTCGCTGGCCTGATCGTCTACTACAA
CTCGTACAGCTTTTTTTACTTGGCCGTCACGGCCGACGGCGACGACACCTCAGACGGCCAGCGCGAGCTGCAGATCCTCA
CGTCCGAGGCCTCGTGGCCCACAGGCGATCTGCGTCTTCCCCTGGCCGCTCCCGTGCTGCTGCCACCAGAGTCCCCCGCA
AGGTCCGACTTGCCGTCACTGTGCGCGGCCGCGTCCTGCAGTTTTGGTACGCGCTCGAGGGCAGAACAAAGACGAGAAGA
ACTTTGGCCCGCTGCAAGAGGTCGGTCCCGTCTATGATGCCTCCCTGCTGTCGGACGAATGCGGCGGCGCCAACGAGCAC
GGCAGCTTCACCGGCGCGTTTGTCGGCATGGCCGCATCGGACATCAACGGCACCGCCATGCCGGCGCACTTTGACTACTT
TGTCTACCGGCCGGCGCACGACCGGACCGATCGGTACGATGATGATCAGGCCCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62