GenePrediction:GLEAN_1104 Details

Name: GLEAN_1104
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:589499..592280 (+ strand)
Length: 2782
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:589499..589589 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_173:589692..589952 (+ strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_173:590018..590255 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_173:590305..590844 (+ strand)
Length: 540
Type: CDS
Source: GLEAN
Position: GCSC_173:590904..590951 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_173:591034..591936 (+ strand)
Length: 903
Type: CDS
Source: GLEAN
Position: GCSC_173:592013..592280 (+ strand)
Length: 268
>GLEAN_1104 class=GenePrediction position=GCSC_173:589499..592280 (+ strand)
ATGGCCGACCGGCACGAGAGTCCTGTGCCGGATGATCTGACACAGGAGGAGGCGAGCCGGATCATCCACTCGCACCGGAA
AGTTCGATATGGTAAGTTGCGCGCCACCGAGACCACGTTAGCCACACGCAATCGATGGCCTGATTTGATTGCATCCTGGC
CTCAGAAGCCGAGCTGACCGGCGCCCGGCCCAGGAACCGCGTGCTGGCCGTGTCGTCAACGCAAAGTAAAGTGCGACAAC
AAGCATCCGTGCGAGAACTGTGTGAAGCGCGACCACGCTCAGCTGTGCTCGTACAAGCCGAACCGGCCCTCGTCCTCGGC
CAAGAATACATCGACGACAGCACCGTCTGAGGAGAGTCACCCGACCAATGTGCCCAAGAAGCGGCCCTTCTCGCCCGACG
AAAGCGACGGTCGGCGCACCAGTCGCGAGCCTTCGACCGGCAGCCCTATCCGGGGTGAGTCTCCGATCTGTCCCAGTTCG
CTCGCATTGCCCTCCCGAACTAACACTCACTGGACCTAGTCGACGCCGATATAAACGAGGTCTCCCGCTACCTGGGACAG
AACAGCATCCCGGCCCTGCTGCGAGAGCAAGGCACGCCGAACCACCAGGAAGAGGGGGTTGAATACATTCGGCAAGACAT
GCGGTCCATACTGGGGCTCGATAACTCGGCCCCCTTCCCACTCATGTCGTCGCGACATCTGGACAAGCTGACGCTGGACA
TCTCGTCCGAGCTCCCGTCTGACAGGGAGGTGATGAAGTATAGATGCCCCCTCTCTCAGTTCCGAATTGGCCGCTTACGT
TCGCAGGCTCTTTGGCGCATACAAGGAAATTCCGCATCCCTTCTGGGGCTTTGTGCTCGACATCGACGACCTCGAGACCA
AGCTTATGGTATATCTGGAAGAGCGGGCAAAGAATGCAAAAACGTTGTCGAAACCCACGAAACCCGTGTCGGCCTCCTGG
CTGGCCATACTCTTCTCGGTCATGGCAGTTGGGTCGCAGTACCACGATTCTCCATATCACATCCGCACCCGTGACTCGCA
GAAGTACATTCAGATCTCGTTTCACTTCCTGCGTCTCGGCAACTTTCTCCTCAGGTACGAGTCATCCCTCTCGCGTGGCA
ACAGCAAGCCGTTCGTGCTGACAAGCAGGCCCAATCTCGACTCCATCCAGGCATTGCTGATGACGGGCTTTGTCCTGTTG
AACGACATGAAAGCAGAGGCTTCATGGGCCCTACTTGGGCTCACGACCCGCCTTGCTCAGTCGCTGGGCCTTGACCGCGT
GCAGAATCTGGACGGCCGGGAGAGTCCGGCTCAACAGAAGAGGGATCTTCTGCGAAGAACCCTATGGTAGGCTATCAACA
TGCGACTGCGAGTTGCTCTGTGGTGCTGACAAGTCCGTCTGGCAGGTGGACGATTGTGTGGCACGACTGTCTGACTTCAC
TGTCGTTTGACCGGTAAGCCGACCGACCAGCTCTCTTTGGCAAAGCGACTGTGTTGCTAACCAGGAAGGACGCCGATGAC
ACCACACTCAGCAAGTCCGATACCGCTCGGCCCGACGCCATCCGCCGGCTGGAACTACCTGCAAGGAATGTACCACTTGT
GCCAGCTCATTGGCAAGCGATTGAGCCCAGAGGTGGCGGCATCGGCAAGCTACACCCAGATCTTGGACAACTGCAAGGAG
GCGGAAGAGATTCGGAGTAAGATGATCCCGCAGCTTCGCACAAAGGAGGCGTGTCGGTCTGCCCTCGACCGGCTGCACTA
CTTTGCCATTCGTCTACACACTTCCTTTGTCGTGTCGGTCTGCTGCCGGCCAGCACTTCGGCGCAGCGACAGCAACCGAC
TCACGACTGAGCAGAAGACATTCCTAGCGGAGAAATGCAAGGAGAACCTGACGGAAACAGTGAGAATGTTTCTGTCGATG
CACCAGTTGTCTGTAATCCCGACACGATCGTGGGCGTTTACGTACCATGGGCTGTCCTCAGCAGTGCTTCTGGGCATTTT
AGGCGAGACCACGGCTGATCTGGAAGTGCGCGGCCTGCAGGGTGACCTGATCAACGCGCTCTCTGCTACGGCAGCCAAGG
ACAAGAAGTCGCCCCCAGTCTACATCCACCGAACAGACCGCGACATTGAGCTGTCCGGCCCTTTGTCTCGTGCTCTTGCG
GCGCTCAAGAACATCTACAATCACGGGTCGATTGCGGGCCAAACGACCAAAAACAACGACGGCAGTGGCAGCCTCTTGGC
AGCCAAGAGCCTGAGTGGCATTTCGACGGCCACGAGCATAGGAACACCATTGATATCCCACGGACAGCTTCTCCCCGGAG
CAGTAGCGCCAGACGGAAAAGCGGCCATTTCACTGAGCGGAGGACACACAAGTTTGGACCCGCACCAGGACGCCGCCCTG
GCCATGGCAGAGATGCAGAACGGCGGGCTAGATCTCGGGTATGAACTGTGTACTATGTGTTGGCCTTTTCCGTCTTCATT
CGCTCTTCTGTGGCTAACACATATCAACACACAGCATGTTCCCTCTGATCCAGCAACAGGGATCAGGAGACACGTTCCCC
GACCTGAGCCACATCGACCCTTCCACATACATGTCCCCAATGGATCTGTATGATCAGATTTTCTGGGGTGAGCAGCAGTG
GGAGAGTATTTGCGAGGGTCTTTTCATGGCTAACGGAGACGCAGAAAACCCGGAACAATGGAATATGGAGCAAGACTCGA
TGAACTTTGACTTTATTGCTCAGCCGCCACCCGGACAGTCGCAGCAGCAATTCTACTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62