GenePrediction:GLEAN_1105 Details

Name: GLEAN_1105
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:592618..596324 (+ strand)
Length: 3707
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:592618..593132 (+ strand)
Length: 515
Type: CDS
Source: GLEAN
Position: GCSC_173:593198..593275 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_173:593374..593871 (+ strand)
Length: 498
Type: CDS
Source: GLEAN
Position: GCSC_173:594475..595177 (+ strand)
Length: 703
Type: CDS
Source: GLEAN
Position: GCSC_173:595350..596324 (+ strand)
Length: 975
>GLEAN_1105 class=GenePrediction position=GCSC_173:592618..596324 (+ strand)
ATGGATTTGCCGATTGTCGACCTGGACGTCTTCCGGACGCAGCCGGCCGACTCGGCGGCGGCGCAGGCGGAGTGCAGCAA
GGCGGCGGAGGCGCTGATCGCGTTTGGGGCGCTGGTGCTGCACGACTCGCGGGTGTCGGAAGCCGACAACGACGCCTTTC
TCGACCTGCTGGAGGACTACTTTGCGCAGCCAGAGGCGACACTACGGCGGGACGAGCGGCCGGCACTGGGCTACCAGGTG
GGTGTCACGCTGGAGAATACGGAGACGCCCAAGTGCGCGGTCGACGAGCCGTGTCTGGACGTGATCGCGCGACTGGCGCC
CGAAGAGCGGCCGCTGGACATTGCCGGCCACCAGCCAGATCCCAAGTGCCGCTTCTTCTGGCGGGTAGTCGAGCCGACAC
CATACCAGACGGCATTTCCAGGACTCAACGCCGACAACGTGGTGCCGGACGCGGCGCTATTTCGGGAGCGATGGGAGCAG
GTCATGGGACGGTGGGGGGCGGCCATGAAAGACGCGTGCGTGCAGCGAGATTCGGTTCGTCGAGGCGCTCTAGGCAAGCC
TGCTAACCGTTCGTGTGCAGAGTCTCGGGCGTTGCCTCTATGGCTGCCGTCGGACTGGGGCTGCCACCAGAGACGTTTGC
GGATGCCGGCCGCTACGGGTGCGTTGAGATCTGACAGTATTTCTTTGTTTGGCTGTCTTTTCCGGTTCTTTCTTTCCTTC
TTGTCTATCCTGCTTCTTCCTCTCTGACGATGATAGCCCCCATCTGCTGGCACCAACAGCGTCCGATCTGCAAAAATACG
GCGCCCTCGACACGATCCTGGCCGGCTTCCACACGGACCTCAACTTCCTCACGATCCATGGCCGCTCACGCTTTCCCGGG
CTGCACATCTGGGCGCGCAACACGGGCCGCCGCATCGCCGTGTCCATTCCGCCGGGTCGCCACCTGCTCGTGCAGGCCGG
TAAGCAGCTCGAGCACCTCAGCGGCGGCCTGATCAAGGCCGGCTACCACGAGGTCGTCGTCAACAACAAGACGCAGGCCG
TCGTCGCCGCTCGCCGCGCCGCCCAGCCCGATCGCCCGCTGATTCGCATCTCGTCGACCTTTTTCTGGCACCTCGCCTCC
GACTGGGACCTGGCGCCGCTGCCAGCGCTGGCCGCCCGTGCCCGCGACGTTCGAACGCAAAATGCCGCCCAGGGTCGCGA
CGAGGGCGCCGAGGTGTCATACCCGCCCATAAAGGTCGGACAACAGGTGCAGAAGTATGCCGTAACCCAGCCTCGAACTC
TCTTGTTTACGTGCCCAGGCTGACCCGCACAGCGAACTGAAGCATATCGCCCTCCTGGCATGAGGTATCTGCTATTGACC
TGTTTCCCTGTATTCTGTGCATCACGAGAATGGCACTACAATCAGCTCTGCAATGCTCCGTACTCTACCTGGTGCACTCG
TGTTGCAGCCGGGTTGCTATGTATATCTCCACTAGCCGTCCAGACCCGTTCTTTCCCTTGTCACACCAATCAAATCGTAG
TGATTCGCGCTGTAGATAAGGTACTCCGTACTTCGGGCGCAACACGTGCTCACGTGGTCATTCTCGTTAGTATAAGTGGG
TCCGGAGGACATAACCGACAATCTTTATTAATACTCCGCATCTGAAAAACGTCTATCAACTAGCTTCCTTTTTCTCGTTG
GGTCAAGCATCCCGCAATTATTACTTTAAACCATCACAGCAGACGATCTGGGCTGCATACGATAGACAGCCACGGCGCCT
TTCTCCTTTTCAGGAATTCCTTTTGGACTGCCACTCAGGTCCCGGTTGGACGCTCCGCCCCACTCTTGACTGCATCCTCA
CCTCTCTCGCTCCCCAGGATCATGGCGTCCTGGGACGACCTGCCGTTTGAGCTCAAGCGGCTCATCTTCCGCGCGCTCGA
ATATTCCGTGCCCGAGCACGACGCCGCACACGTCAAGGGGCGGAGGAAGCGCGGCCCGGCTGGCCTGGCGCCGCTGGCCG
CGGTGAACTCGCAATGGCGCGACGCCATCGAGGCCATCACGTTCCAGGGCCTCATCGTCAAGACCAGCGAGGTCAACGAC
TTTGAGGGCTACTTCCGCCAGAACCCGCGGCGCCAGGCAGCCCTGCGTCGCGTGTGTATCCTGGTCGAGCTACCGCGCTA
TGCGTCGCGGCTCAGCCGGGTGTGTGAGACCGAGGAGGAGCTCGACACCAACGACAGCATCTTCTCCGACACGTTGTGGC
ACTTCTTCTCCGCCATGAGCGCCTGGGACGCCGACGTGCTGCGCCAGCACTACAAGTCGCCTGGTGTCGCCCTCGAGATC
GTCGCTCGCTCCACTAGCGACAAGCCCGCCCTCTTCGGCGAGAAGGGCATCTCGGACAGCGGCGAGTCGCGCTTCTTCGA
GTCGCAGCTCGACCTCAACATCGGCGCCATGCACGAGCCCTACGGCCGCGTCGGCCTGCCCGAGGTCGCCGTCGTCACTA
CTTTTAGCATCCTGCGGCGAAACCACCGCTGCATGACGCCGCGGTCGCTGCTACACATCTTGCACAGCCTGCCTCGCCTG
GTGCATGCCGATATTGAGCTGTGGCACCATTTCAGCGACGAGGCCCAGCGACAGGCCGATCAAGGTGAGCTTCTCTTTCT
TTCTTTTTTTTTACCTTGTAGTTTCTTTCTTCTCCTCTCTCCCCTCCACTAACATCCCAGATCTCGCCGTCACTGTCTCC
TTCTGGCCAAAGACACCCAAAAAGCTCACCCTCTACCGCTTCTCCGATGCCTTCAACATGGACGAGCAGGTCTGGGGCCA
CGACGAGCGATATCCTTTTCTGGCCCGCCGTATCGCCGAGTACAGCCCTCATCTGGAAGAGCTCGCCGTCTCGGATTTCA
TCGATGCCGACCACTTTTTCGAGCCGTTCTACACCCCCCAGCGCCGCCTCCACATGCCTTACTGGCACAGCTTGCGGGTC
CTCGCCCTCACGTCAACATCCATCTGCTCCGGTCGGCCGGAGGTGTCGATACATAAGCTGCTGCACGCTGCCGCCCTGGC
GGCCCGACGCATGCCCGTTCTGCGTCTGATGGAGCTGTACAACGCCGAGCCCAACGAGGGCGGCGTGTTCCGGTATCTGG
TCCGAGACAGCTCGGCCTCCATTGCCTGGGAGAGCTCATGGGACTTTCGGATACCGGACAACGTGCGGCAGGCTTGGGCG
CCTGTCCCATTGCACAGCCACCGGCTGGAGCTAGAAGTGCTGCCCGAGGAGACCCTGCCGCGCTACGTTGGCCCAGCCTG
GTTTGTACACGCACGCCTCATGTCGAGGCCGTATCTGCTGAACCCGGCATCATCACGCGAGATCGCAAAGGCGAACGAGC
TGGACGACTTCGAAGAGAGCTACCGAGACCTCAGCGACGGCTTCACGCTGAACCGGCGCGAACGCGACGTTCCCCGACCG
AGCCGGCGCGAACAGGAGATCGAGGCCGTGAAGAACGGCCTGAAGTTCCTTGCCGACGAGCTCGAACGGCTGCAGAGCCT
GGACGAGGAGGCCGACAGGATGGACGAGGAAGCTGGTCTCTATGACCACGTCTTCAAGTGTGATACCGATATGATAGACC
GAGACAGCAACGACTCACGAGCCAGCATCGAGATCATGTATCAGGATGACCCCGATGCCGACGAGGACAGACGGGACGAG
GACGACGAGGCATGGGAGACGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62