GenePrediction:GLEAN_1106 Details

Name: GLEAN_1106
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:601331..602953 (+ strand)
Length: 1623
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:601331..601393 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_173:601453..601522 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_173:601688..601790 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_173:601860..601989 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_173:602196..602749 (+ strand)
Length: 554
Type: CDS
Source: GLEAN
Position: GCSC_173:602800..602953 (+ strand)
Length: 154
>GLEAN_1106 class=GenePrediction position=GCSC_173:601331..602953 (+ strand)
ATGGAGCACAGGGAAGGCACGACAAAGGTGTGTTCGGGGGCGCAAACGAAGAAGGTGCACAATGTGAGTTGATGAGGTCG
CAGTCTTACAGTTAAATATGCCACTCAACACGACAGACATAGGCCGACCTGTTTTCAGCCCTGCAGGAAACCAAGATCAA
GGCGACGAGCCGGGATTCGTTGCGACTGTACTGTGAGCGAGCTTACAAGGCGTTGGGAAACTGCGCCTTCGTCTGCTGAC
GTGCATAAAGATGCCATATTCGTCTCATTCTGCTGTGCCTGTGCGAACGGCTACGACTGTGCGCTCTTCCCATCCTCCAG
GAAGCCGCCGACAGACTGCTGACAATACGGGGAGTAGCGTCGCTGATGACGTCCGTTCTGGCCATGTCCCACTTCCAGGA
CATGTTCCACAGCGGCATGACAGGATCCAAGGTGTCGATCATCTTTTCGCTCCACACGGTGTAAGACACGACCGCTTATG
CTTCTTCTGGAAACGTGACTCTCCCGGACTAACTGTGGCTGGACAACAGCGGTGCCATGGTGATGTCGCCGGGCGCTGCG
ATCTTGTCGGACCGCTTCGGTCGGCGCGTTGCCATGTTCTGCGGCGAATGGGTCATCATCATAGGCATGGTGGTCGCGGC
AACGTCTGGGCAGCTGGAGGTTGAGGAGATGCGGACAAACATCCGACTGGACGGTATCGACAAGTCGTCATGGGATTGCA
AGTTGGAGAGGGGAGGGGGAATAAAGGGACAAAAAAAGAAAGAAAGAAAGAAAGAAAAGAAGAACAAAAAAGGAGACGAC
ATGACTGATCATTCCCAGACCGTCCCCTCTTTCTGACGCACAGCGGCCGCTGGCGCATGGCCTAGGTGCTGATGATCTCC
GTCTTCGGCCAGTTCTCCGGCAACGGGCTCGGCTACTTCAACACGGTCATCTTTGCCAACCTAGGCGTGACCGCCGTGGC
CCAGCAGCTTGGCTACAACCTGCTCAACGCCGTGCTGTCAGCCCTGGGCGCCGTGGCCACTGTGGCCGTGACGGATCGGA
CGCCACGTCGCCGCGTCCTCGTTGTCGGCACGCTCGTCTGTGCTGCCGCCCTGGCCCGCAATGCCGGCCTGTCGGCCGTC
TTGGCTCACCAACCCCAGAACATCGCCCCGTCTTACGCCCGCGCTGCCCTCGCCAGGTACCTCCTCTTCAACATCGTCTC
TTCCTTCACGTACACGCCGCTCCAGGCCGTCATCCCGGCCGAGGCCCTCGAGACGACCACGCGCGCCAATGGCCTCGCCC
TCTCCAACGTGCTCGTCAATGCCGTCGGCTTCATCAACCAGTTCTGCGGACCCATCACCCTCGGCAACATCGGCTACCGC
TACATCTACATCTTTGTTGGCTGGGACCTGGTCGAGGCCCTGCTGTGGTATCTGTTCGGGTGAGCCCCCTCTTTCCTCTT
TCGGCCGAGCCCCCACTCTGGCCTTCCAGCGTCGAGTCTCTCGGCCGCACCCTCGAACAGCTCGCCTGGGTATACGAACA
GCCCAATCCTGTCAAGGCCTCGCTGCGTGTCGATAATGTCGCCGTCCAGGACAACGGCAAGGTCACTGAAACTGCGGTGT
TTCCTACGGCCGAAAAGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62