GenePrediction:GLEAN_1108 Details

Name: GLEAN_1108
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:617647..618935 (+ strand)
Length: 1289
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:617647..618341 (+ strand)
Length: 695
Type: CDS
Source: GLEAN
Position: GCSC_173:618482..618803 (+ strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_173:618873..618935 (+ strand)
Length: 63
>GLEAN_1108 class=GenePrediction position=GCSC_173:617647..618935 (+ strand)
ATGAAAGCCTGGGTAGTGGTCAAGAACGCCGAGCCAGGCTACGCGCTGGCTCTGCAGGACGTGCAAGACCCGCCAGCCGT
TGCAGCTGCGCCAAAGGGTTCCGACATACTCGTTCGCATCACCCACGCCGCCCTCAATCCGGCGGACCTGCATTTTATGC
TCCACCTGCCGACCTGGATCCCCTTCCGCCGCAACGCCATGCCCGGGCTCGACTTTGCCGGCGAGATCGTGAAGCTGGGC
CCCATGGCTGCGGCCGCTCCGGCGCACGCAGCGGCACCGCTGACCGTCGGCGCGCGTGTCTCCGGCTGTCTGAGCATCAG
GCTCGTTGCCACAGGTCACGGCTCGCTGGCTGAGTACATCACGGTCCCGGCTGAGGTGGTGGTGCGGGTGCCAGACGGTC
TGTCGTCGGAGACGGCCGTCGGCATGCTAGGCTGCGCTGGCCAGACGGCACATCTGGTCATGACGAACCCGGGAGCAGAT
GCCGTCTTCCAGTCGGACGCGGCCAAGAGCCGCACGTCGCCGCCCCGTGTCCTCATCAACGGCGCCAGTGGTGGTGTAGG
CTCGCTGGTGACGCAGATCGCAAAGGCCCGCGGGGCATACGTCGTGGCCGTGTGCTCGGCGGCAAACGAGGCGCTGGTGC
GGCGCAATGGTGCCGACGAGATCGTCGACTACCAGACGCACGACCCGCTGCCGCAGTATCTGGCCGAGACCTATGGAAAG
GCGGCCACTGACGGCAGGACGACGGCAGCAGCAGAAGTTGCAGAAGAAACCGGCGAGCAGAAGCAGCAAAGGCAGAAGAA
GCGGCAGATACAGCAAAAGCAGATGCGTCCTCAAGAGCGGCGAAACAGGCCAGTAGCGGGCCTTTCGACCTGATCGTTGA
CTGCATGGGCGACCAGCCGCTGTTCCTCCAGTGCTCCCCGTACCTGGTGCCGCGGGGCTCGTTCCTGTGCATTGTTGGCG
GGCCCTCGCAGGGCGTTGTGCCATTTGTGCGCAACAAGATCTTGCCTTGGTTCCTTGGCGGGCCTGCGCGCACGTACCAG
ATACTGGGTCTGGCGCCGTCAGGCGAGCGGGCTCGGGCGGTCGCAGCTTGGTACGCTGACGGCACGGTCAAGGATATGCC
CATCGACTCGGTGCACCCCATGGCGGATGCGGTCAAGGTATGCCTCCCATCTTCTTTTGGCTTTTGGCGTGTTAATAGTT
GGTCGGCAGCGTGGCTAACCAGACAGGCGTACGGAAAACTGGCGACCAAGCGGGCCAAAGGCAAGATTGTCATCAAAGTG
CAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62