GenePrediction:GLEAN_1109 Details

Name: GLEAN_1109
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:619499..621126 (+ strand)
Length: 1628
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:619499..619594 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_173:620252..620762 (+ strand)
Length: 511
Type: CDS
Source: GLEAN
Position: GCSC_173:620819..621126 (+ strand)
Length: 308
>GLEAN_1109 class=GenePrediction position=GCSC_173:619499..621126 (+ strand)
ATGGCCGATGTGGACTATCTTGACCTGCAGCCGACGCCTGTGATTAGTCACGTATCGTCTGCATTTGCTGCACTGTTCGA
CCCTCTATCATCAGCGGTACGGAAACCAAGACACAAACTACCGTAGGACCACAGATCTAGATACCCACTCCAGCTTCGGG
TGCGGAGACGAGCACAACCTGAAGGACCCGCCGAACACTGCATCAACTCGCACGACTGCACGACGAGGGCAAGCGGGCCT
AAATTTTCGGCTGTTTAGGTACATTGCCAACACTTTGGGCTAGCGATATGCCCAAATCTATGCCAATGTGAGCCAAGATT
CTCAGTTTGGGCGAGATCTATTCCAGAACTGCTAAACGTCTTATCATAAGACAGATGCTCAAGCAAAGACAACAGTACGA
ATGGCCGAAAATTGGGAGCTTACAAGAGAGTTGCATAGTAAGAGCGGCTATAGGTACCCGCTGGTAAACGGTAGTAGGTT
GCTTTGTAATTGGTACGGTCGTTACAAGGGAGACGTCTGTAAGTGGTAGTTATAAAACGCCATAGTGCGAATACTCACTT
TTACAGTGCGATTAGCAGACGGGTGATCGCTTCTGCAGCAATGGCCTAGATCACGAAGGCAACAAGCGGGGTGGCAGTAT
CCGAGCTCGTACTATGCAGCAAACAGGTGGTCAGCTTTTTCCACGTGTGCACAGACTTTTGGTGCTTACGAGGAAATCAA
GCGTTAGAATCGCCTTTCCGCGCACTTGGCCAGCCACAGTTCTCGGCATCCGCAGTCCACCAGCAGACGAGGCATTCTAC
CCCCGTATTCTACACGATGACTTTGAGGGGTCAGCTGCGCGTGCGGCAGGCCGTGGCCGCGGACATTGACGCGATCACGC
AGGTGTACTTTGCAGCGTTTGGGCCGGACCCCATGTCACCAGCCATGTATCCGCCCGCGGGCGTGCCGACGGCGGACGTG
GTGGCCAAGTTTGCGGGCAGCATCTTTGACGAGGCGGCGCCGGGAACGGGCCGGGAGGTGCCGGTGGTGGTGGCCGAGAT
GCTGCGCGACCACAAGGACGAAGCCGAGGAGGAGGGGTATGAGATCGTGGCGTTTGGCAAATACGTCGTGTACCACCGCG
AGCGGACAGAGGAAGAGTGGACCAAGCCGGTCGTGTTCACAGAGGAGATGCTGGGCCAGGGTGCCGACCTGGACGTGTTC
AACGGCTTCATCGGCGGCCTGCACCGGAAACGGGCAGCGGTGGTCCGGGGGGCAGCCCATGTTTGTGAGTAGGCAGAGCT
GGGGAGAGGCTGACAAAGATGTATTTTGCTGACTAAGCAGACCTCAACATCCTTGCGGCGGCTCCCGACCGACAGCGTCT
CGGCGCCGGGTCGGCGATCCTGCGCTGGGGCGCCGAACTGGCGGATGCGGCCGGCCTGCCGCTGTGGCTAGAGGCCTCAC
CCACGGGATATCCGCTGTACCTGCGGCACGGGTTCGTGCCGGTAGACGTGCTGGACTACTCGCTGGTCGCGTACGGCGGC
ACGGAGGAGGGCAACTGGGGCATTGACAGTGTGCCAGGCGTTGCCGGGCCGCGGCTCCGAGGCTGGTACCGGACGGTGGT
GATGAAGCGGGAGCTGTCAAAGAGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62