GenePrediction:GLEAN_110 Details

Name: GLEAN_110
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:765239..765973 (+ strand)
Length: 735
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:765239..765338 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_179:765391..765494 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_179:765548..765973 (+ strand)
Length: 426
>GLEAN_110 class=GenePrediction position=GCSC_179:765239..765973 (+ strand)
ATGTGTGATAGTGGAACCTACAATGAAGTTCCGTCCGACAAGGAGCGGTTTGCCCTGCTGAACAAGGCATATGAACTAAG
CGAGATGTTTTGGGACTCGGGTAGGTGGCTGGACTCAACAGAAAGTGTAGAACCAAGCTGACGGTGGCCCAGAAGACCTG
TATATGGACTCGGGGGACCTTCTCAGCCGGTACTTTGCGGCCTACCCGGAGAAGCGCAAGGACATCTTCCTGGCGACCAA
GTTTGGCATCCAGCTGGTTGGCTCGCCGCCAACCTTCAAATCGGCTCGTCACCGGCATACTGCCGCAAGGCGTTTGCCCG
TTGGCCTAAGCGTCTCGGCACCGACTACGTCGATCTGTACTACGTGAACCGGCTAGACGGCAAGACGCCCATCGAACAGA
CCATGGCTGTGCTGGCCGAGTTTGTTCGAGCCGGCAAGATCCGCCACATCGGCCTCAGCACCTACAGCGTGTCGTCGCTG
CGCCGCGCCCACACCGTCCACCCGTCCGCCTGCATCCAGCTCGAGTACAGCGTGTTCTGCACGACCATTGAGACCGACCC
GACCGGGGACCTGCGGCGCACCCTCCTGGCGACGGCCCGCGAGCTCGGTGTCGCTGTCGCCGCCTACAGTCCGCTCGGCC
GCGACATCCTGACTGGCTCGGTGCGCGACAACGCGGACCTCAGCTTTGCCGAGACATCGGAGCTGCAGGTGCCGGTGTGC
AGGGCAGAAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62