GenePrediction:GLEAN_1110 Details

Name: GLEAN_1110
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:627511..629676 (+ strand)
Length: 2166
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:627511..628973 (+ strand)
Length: 1463
Type: CDS
Source: GLEAN
Position: GCSC_173:629055..629676 (+ strand)
Length: 622
>GLEAN_1110 class=GenePrediction position=GCSC_173:627511..629676 (+ strand)
ATGAATTCACGGCCATTAAAGCGGCGGAAGGGCAGCCCGCCTCCTTCGGGAGAAGGGCGGACGTCTCGGAAGAAGGGCCC
GACCGACGAAGTCGAGCCGGCCTTTTTCAACAAGAACGCTGCAAACTGGGATCTAGAGCGAGATTACGCCAAGAAGGCAA
AGAAGCAGAAGACAAACGACCGGCTTCCGATCCGAACGGCAGACGGTGTTCTGCGGGAGGCTGTCAAGGTGGCCCCTGAG
AGCGGAGCCGGCGGGGAGGACGCATTTGGCAGCGATGACTCCGACTCGGACAACGGCCACAGCCATGGCAGAAAAGACAA
GAACGGCCGCAGACACGGCAGGGATGCAGAGCGGACAGAGGAAGGGGCGAAGCCGCGGCTGTCGGAGGCACAGCAGGTGC
GGGTGGCCAAGGAAGAGCTGGCCAAGATTGCGCTGAAGCTGAACGAGAACCCGGAGGACAACCCGGGCGCATTCAAGGCG
CTGGCACAGGTGGCACGCCAGGCGACCTGGTCAGTTGCGGTGCAGAAGCTGTGCATAGCGACACAGATGGCAGTGTACAA
GGACGTGATTCCGGGGTACCGGATCCGGACTCTGGGCGAAGAGCCGGCGGCAGCGGGCGGCGGCGAGAAGCTGTCGTCGG
ATGTGCGGCGGATCCGGGCATTTGAGCAGTCGCTGCTGGCCGGCTACCAGGGCTACCTTCGGGAGCTCTCGCGGCTCGGC
CGCGGACGGTCGGGCGGGGTGTACAACGAGAGCCTGGCCAACGTGGCGCTGACGTGCGCGTGCACGCTGCTGAACAGCGT
GCCGCATTTTAACTTCCGCGAGGACCTGCTGCGGATCATTGTCGGGCGGCTGAGCGGACGGCGAGTGGACGAGTCGTTTG
TGCGGTGCCGGACCGCGCTCGAGACGCTCTTCCGCGAGGACGAGGAGGGCCGGCCGTCGATGGAGACGGTGGCGCTGCTG
GCCAAGATGATGCGAGCGCGCGACTACCGGGTGGACGAGAGCGTGCTGAACACGTTCCTGCACCTCCGGCTGCTGTCCGA
GTTCTCGGGCAAGGCGTCGCAAGACCGTGTGGACCGGCCGGGCGACGATGAGACGGCCGGAGCTCGCAAGTCGCGCGAGA
AGAAAGAGTTCCGTACTAAGCGGCAGCGCAAGCAGCTCAAGGAGCAAAAGGCCCTGGACCGCGACCTGGCCCAGGCCGAC
GCCCTAGTAGCCCACGAGGAGCGCGACCGGATGCAGTCCGAGACGCTCAAGCTCGTCTTCGCCACCTACTTCCGCATTCT
CAAGCTGCGCGTGCCGAATCTGATGGGTGCCGTGCTGGAGGGGTTGGCCAAGTATGCCCACCTGATCAACCAGGACTTCT
TTGGCGACCTGTTGGAAGCGCTCAAGGATCTTGTCCGCTACGGCGACGGCCAGAGCAACAGCAAGCCGGATGCCGACGAC
AAAGGGGACGAGGATGAGGACGAGTTTGGCAGTGACGGCAACGACGACGACGACGACGATGACGATGATGACGACGATGG
GTTTGGAGTGGCGCGAAACCTCAGCCGCGAGGCACTGCTCTGCACGGTGACGGCCTACGCGCTGCTGGCCGGCCAGGACG
CACACAACGCGCGCAGCGACCTGCACCTGGACCTGTCCTTCTTTACGACGCACCTCTTCCGCAGCCTCTTTCCGCTGGCG
CTAGAGGCCGACATTGAGAAGCGGGCCGGCTCGCTGCAGCAGAAGCTGGCAGATGCGACGGGCAGCGGCAGTAGCAGCGG
CCACAAGGAGGGCAGCAAGGTTAACCTGCAGACGACGACGGTGCTGCTGGTGCGCTGTCTGACGGCGGTGCTGCTGCCGC
CCTACAATATCCGGTCAGTGCCACCGCTGCGGCTGGCGGCCTTTTCGAAGCAGCTCATGTCGGTGGCGCTGCACGTGCCG
GAAAAGTCGACGCAGGCGGTCCTGGCCCTGCTGCTGGACGTGGCCGACACGCACGGCAAGAAGATCAGCGCGCTGTGGAA
CACGGAGGAGCGCAAGGGCGACGGGACCTTCCAGCCGTTGAGCGAGACGGTCGAGACGAGCAATCCGTTTGCCACGACCG
TGTGGGAGGGCGAGCTGCTGCGGCGGCATTACTGCCCAAAGGTGCGCGAGGGCGTCAAGGCGCTAGAGAAGAGCCTGACG
ATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62