GenePrediction:GLEAN_1112 Details

Name: GLEAN_1112
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:641201..643548 (+ strand)
Length: 2348
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:641201..641270 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_173:641350..641422 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_173:641488..643002 (+ strand)
Length: 1515
Type: CDS
Source: GLEAN
Position: GCSC_173:643245..643548 (+ strand)
Length: 304
>GLEAN_1112 class=GenePrediction position=GCSC_173:641201..643548 (+ strand)
ATGTTGAGCACAGAGGCTCAACAAGCCTTACCGCATGATGCTCAAGTAGCTCTGCAGCAGGTGGACAACTGTAAGACCTG
CTATTCTTTTGTCGATCTAGCTCCTATCTGACCACTGTGTAGTGAAATATTTCCTTATCTCTGCCCCAGTCGACTGGCAG
ACTGACCAGTACATTCGCCGGTTTCTGCTTCCAACCGGTGAATACGTTTCTTGCGTGCTCTGGTGCGTTGATTATCCGAG
ACCCCTGCAACAGCAAGACAAAATATCTAACTCGGAATGCTTTATAGGAACAATCTCTTCCACATTTCTGGCACAGATAT
TGTGCGATGCCTGTCGTTCCGTTTCCAGGCATTTGGCCGGCCCGTCAAGAATTCGAAGAAGTTTGAGGAGGGCATTTTCT
CAGATCTCCGAAACTTGAAGTCTGGAACCGATGCCTCGCTTGAGGAGCCGAAGAGTGCCTTCCTCGACTTTCTTTACAAG
AACAACTGCATCCGGACACAGAAGAAGCAGAAAGTGTTCTATTGGTATAGCGTTCCGCATGATCGCTTGTTTCTTGATGC
GCTGGAGCGGGATTTGAAGCGCGAAAAGATGGGCCAGGAGGCCACCACAGTGGCCGTCAGCGAACCGGCGCTTTCCTTCC
AATACGATTCGTCGCAGTCGCTGTATGACCAGCTTACAAAGGCCCAGCAAGCAAACTCATCGTCCTTCAGTGCCCAGCAG
GTGTCATTTCCGCAGTCACAAACAGCTTCTCCGGTCATGCGTGCAATGGAGGCTATGCCTCCGCCGCAGATGATCCCGCA
GTCAATGGCTCCGTTTTCCGACGGCATGGACGGCATGGTTCCATACACAACTGCGATGCAGATGGCGCCGACAATGGCCC
AGCACGTGGTGAAGCGGGAACCCGACTTCGCTCGTGTCCAGTACAACCAGAACGGCGTTCCCGTGTCCGCCGCACACCAG
CGCCACGCGTCCATGCCTGCGTACGGTCTTGAGTACTCTCCAGCTCCGTCATTTGTGTCTTCGCAATATGATGACTACGG
CAACCGGGGGATTTCGTTTGAGCCGCTGACGCCGCCGCAGCTGGCAACTGGAATGACGACTGAGCCTGCGTACATTGCCA
ATGAAGAGACTGGCCTGTACACTGCTATTCCCGACCACATGAGCACGGCGATGAACGGCCTTAACGGCATGATCCAGCTG
CCTCCCTCGAACCTGTCCGGCTCGCAGTTCTCTCGCGGCTATGGCTCGAACAGCATGTACGCCAATGTGATCGAGGGCTC
GCCTACCTACAAGCAGCGCAGACGCCGTTCGTCCATCCCGCCTGGCATGTCGGCTATTGCGGCGGCAGCGGCGACATCCG
CTGCGCACCGGCCGTCTGACCTTCGGCGTTCCGTGTCCGTGTCTGTTGGTCCGGTTCTGGAAGCCGACGAGTCGCTGGAC
AACTCGCCGCCAGGCTTGACGTACAGCAGCTCGGGCGTGTCCCTGACTGGCCAGCAGCACAAGGAGCTGCTTGATCTTTC
GCGTCACGGCACTCCGCTGTCGACAGTAGAGGGCAGCCCGGTGATGAACACCATGGGTCTTCAGCAGCAGGACTACTCTC
AGCTGGCACACGACGATCTGTCAATGTCGCACAGCTCTGTCACTGGTGCAGAAGAGCGGCGGCCAGTGCATGCGAGCCCG
AACGTTGTTCGGAGAGCGCGGTCGGCTACAGTTATGGAGCTAGGGCCGTATCCGCAGAAGTCGCACTCTTGCCCGATCCC
GACATGCGGACGTCTGTTCAAGCGTCTCGAGCACCTGAAGCGGTAAGAAAAGACAGCAGCAAGCCAACCCGTTGCGAAGC
TTTTATCTGACCTATTTCCAGACATGTGCGAACACATACCCAAGAGAGACCTTACATCTGCCCTTACTGCAGCAAGGCGT
TCTCTAGGTCGGACAACCTGGCACAGTACGATCCCCTTTCCGATGTCTTGCACTGTCTCCCTCATCTGTTGGAACAGTGT
GTTGCAACGTGTTTTGTGTGCAGATAACTAACTGTATTGATTAGGCACAAGCGGACTCACGATCGTGAGGGTGGGGAGAA
CAGCTTCCCACTGTCCGGTGAAGACGACGAAGAATATTCGGGAGAGGACCGGCTCGGCTCGGTCGAGGAGGCGTCCCCAA
CGTCGGAGGGTGGCTACGTGGCTAGCTCACTCAACTCGGTCGTCAACAATAGCATGGCGCCGATGTCCAACGGTGCCTCG
GCGGCATCGAGCATAACGCAGACGAGCACATTCAACAGCCTGCAGACGCTGAGCATGCCGATGACCATCAGCCAACCCCA
GTCGATCAACGCTGGGGCCTTGATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62