GenePrediction:GLEAN_1113 Details

Name: GLEAN_1113
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:645629..646480 (+ strand)
Length: 852
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:645629..646480 (+ strand)
Length: 852
>GLEAN_1113 class=GenePrediction position=GCSC_173:645629..646480 (+ strand)
ATGACCCGCTTTCGTCCCTGCATCGACCTGCATGCCGGCCAGGTCAAGCAGATTGTCGGCGGCACGCTCGACTCGGCCAC
GGCGGCGCTGCAGACCAACTTTGTGGCGTCGCAGCCGCCCGGCCACTTTGCGGCACTGTACCGGACGCACGGACTGCGTG
GCGCTCACGTGATCATGCTGGGTAGCGGGCCGGCCAACGTAACAGCCGGACGCGAAGCCGTGGCCGCCTGGCCGGGTGGC
CTGCAGATCGGCGGCGGCATCCGCGACAGCAACGCTGCCGAGTGGATCGCTGCTGGCGCCGACAAGGTCATCGTCACGTC
GTATCTCTTCGAGGAGGTGTCTGCGAGCACTGCCGCCACCGCTACGCATCACTTCAGTCAGGCCCGTCTCGACTCCGTTC
TCGCGGCTCTCGGCGGCGATTCCCAGCGGCTCGTCATCGATCTCAGCTGTCGTCGTCTCTCATCCTCCTCTTGGGCTGTC
GCTATCAACAAGTGGCAGACCCTCACGGACATGCTTCTCTCCGCCGAAACTCTCGCTCGCCTCGCTCCTTACTGCTGTGA
ATTCCTCATCCATGCTGCTGACGTCGAGGGGCTCCAGCGTGGCATTGACCAGGACCTCGTCGCCTCTCTTGCCGCCTGGT
CTGTCGACCTCGATCGTCCCATCACCTATGCTGGCGGTGCTCGTCACCTCAGCGATCTCGAGCTTGTCGATCGCCTCAGC
AACGGCCGCATTCATCTCACCATTGGCAGTGCTCTCGACTGCTTCGGTGGTTCTGGCGTCAAACTCGACGACTGCATCGC
TTGGAACAACTCTCACCCAGAACTGCCACCATCACACGACATCACGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62