GenePrediction:GLEAN_1114 Details

Name: GLEAN_1114
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:653467..655442 (+ strand)
Length: 1976
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:653467..653793 (+ strand)
Length: 327
Type: CDS
Source: GLEAN
Position: GCSC_173:653861..654336 (+ strand)
Length: 476
Type: CDS
Source: GLEAN
Position: GCSC_173:654404..655442 (+ strand)
Length: 1039
>GLEAN_1114 class=GenePrediction position=GCSC_173:653467..655442 (+ strand)
ATGAAGCGAAAGCTCGATGAACACAACAGCCCCGCTGTGACCGATAAAGAAGTCGGTAAGGCTGCCCCGGAAACCAAAAA
CACCTCGCAAAATGCCGACGCTGTCGACGTGGCGGCCAAAGAAACTTCTTTTGCCGACCTTGGTCTCGACCCACGGCTCG
TCCAAGCTGTTGCTCGACAGAGCTTTGAGAAGCCGACTCTAGTACAAAGGAAAGCCATTCCTCTGGCATTGAATGGACAG
GATCTTTTGGCTAAGGCAAAGACGGGATCGGGCAAGACAGCGGCCTATCTGCTTCCCGTCCTTCAGGTCATTCTGAAACG
GAAACAGGTAAGGCAGAAAGCAGTGACGGTGACGCTGCAATAAAAGACCTACTGACCATATTTCCACTGTACAGACTGAT
ACCACTGCATTTACATCCGCCCTCATCCTTGCACCGACGCGCGAGCTGGCCGACCAGGTGTTTAAGAGCATTGCCGAGTT
CTCGTCGTTCTGCGCGAAAGACATTACCGCCGTCAAACTCACTGACAAAGTATCGGATGCCGTTTTGCGGTCACTGCTGT
CCAACATGCCCGATATCGTTGTGTCGACTCCGTCGAGGGCGTGGCATGCTGTTAGCAGCTCGTTCATGACGCTCGACAAA
CTGACGAATCTGGTTCTTGACGAAGCCGATTTGGTACTGTCATATGGATACAGCGAGGACCTGGAACAAATTTCTGGATC
GCTTCCAAAGGGGATTCAGACAATCCTAATGAGTGCCACTTTGACCACCGAAGTAGACACACTGAAAGGCATGCTCTGCC
GGAATCCGACTTTGCTGAACCTGGAGGAGCGAGATGCTGAAGGCGAGGGTGTCACACAATACGTCGTAAAGTTTGTATAT
GCCCCTGCGTCACTGCGTTTTGTGCCCTTTTCATAATAGCTAACTCTCTTGCCTTAGATGTGCCGAAGACGAAAAGTTCC
TACTGGCATACATCATCTTCAAACTAAAGCTAGTCACCGGAAAATGTCTTGTGTTTGTGTCCGACGTCGACCGCTGTTAC
CGCTTGAAGCTGTTCTTCGAACAGTTCGGCATCCGCAGCTGCATCCTGAACTCGGAGCTTCCCGTCAATTCGCGGATAAA
CTGCATCGAAGAGTTCAACCGCAATATGTATGATATCATTATTGCCTCGGACGAGCACGAACTATTGGGAAATGAAGAAC
AGGCAGACGAGCAAGCGACAAAGGAGGGCAAAGGCGCAGAGGCGCAACCGAAGAAAAAGCGCAAGACCGCAGCAAAGCGA
GACCGCGAATTTGGCGTATCGCGAGGAATCGACTTCAAAAACGTCCGCGCTGTGATCAATTTTGACCTGCCCACTTCATC
CAAGTCCTATACACACCGGATTGGCCGCACGGCTCGGGCGGGCCAGACAGGCATGGCGCTGTCATTTGTGGTGCCTTCAG
CTCTGTACCGCAAGCATATTCCAACGACGGTGGAGAGTGCTGAAAACGACGAGAAGGTTTTAGGACGCATCACGCGGCAG
CAGGCCAAACTGGGCAAGGAGGTCAAGCCGTACGACTTTGACATGAAGCAGGTGGAGGCGTTCCGGTACCGCATGAACGA
TGCGCTGCGGTCGGTGACCAAGGTGGCTGTGCGCGAAGCGCGAACGCGGGAGATCCGACAGGAGCTGCTTAAGAGTGAGA
AGCTGAAACGGCATTTCGAAGAGAACCCAGGAGAGTTGCAACACCTAGCACGCCATGATCACGAATTGCGGACGCTGCGC
GCACAGCCTCACCTGAAGCACGTGCCAGACTACCTGCTGCCACGTGATGGAAAGAAGGCGCTGACAGCGTCTGAAGTCGG
CTTTGTTCCACTACGGCGGAAGGACGGCAAGAAGAATGATAAGCGGAGGACCAAATACTTTGCCAAGGGAGGCAAGAGCG
CGCTCAGCAAAGGCCGGAAGGTGAACCCGTTACGGACGTTCAAGACAAAGCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62