GenePrediction:GLEAN_1115 Details

Name: GLEAN_1115
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:657231..659965 (+ strand)
Length: 2735
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:657231..657333 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_173:657417..659335 (+ strand)
Length: 1919
Type: CDS
Source: GLEAN
Position: GCSC_173:659435..659965 (+ strand)
Length: 531
>GLEAN_1115 class=GenePrediction position=GCSC_173:657231..659965 (+ strand)
ATGAAACGATCGTCAGCATCCGACACCAGGCCATTGCCCTTCTTATGGAGGGAGTCAGTCAGGACCGATGACAGACAAGC
TGCAAGGGCATCGAATCTGCTTGGTGAGTTTACTATAACGTTATCTCAAGACACCCGCAAAGATCAGTTCTTCAGTTCTT
TAACATCACTTTTACTCTATGAGCAGACGTTGGCAGCAACAGCAGATTCGGCGACAATGCAACTCACGATTCCGGAGGAA
ATGGCGTGCCCGCTACAACAAATAGTCTTATTTCTCTGATGTCCAGAATAGCCAAGGAGAAGCAAAGTGTCACATCGCTA
CAGAGAGGCAGAAAATACGGCGGTTATGGGCTCAGTAGTCTCACCATCGGTGAAGGCAGTCGATCCAGTTTGACCGAGCG
AGCCTCTTATTCTTTGGATCTAGGCGGCAGCTCTCTTTCGTCAAATAAAGATCCAAACAACGGCCGAAAATTATTGGACC
GTCTTCTGAATCGGTCAAACGGCCTATCATCACCTTTAGCCTCCTCTTCCTCCTCCTTCGCAAACTTTGCTTCGAAGAAA
AACAACAACACTGCAGCAATATCGGACCAACCGGAGAAAGGCGTTACTTCAGGCCTACTGCCAGCGACAGCTGCCAAACC
CCATCTCCCCTGCATTCAGATTGACAAGCCGATTGGCAGCGGCAATTTCACCACCAGTTCTGGGACTTCAGCCTCAACGG
ATTCAAGCTCGCACAACATATTTGAGGCCATTGGCCACTTACCAACAATTTTCAAGAGCGTTGCGTCTGCACAACCGTCG
TGTCCGCTCAATGCCTCAACCCAGTCTCAGGCCCAAACAGCACCCGACGTGACGGCGGGCCGCGTCATTGACCTTATTGA
CAGCGAAAGCTCCAGTAGTGGCAGTAGTGGCAGTAGTGGCTCGAAGGAGCAGGAACCCAGTCAAACTTCAGATGTTGACC
CTGTCTTGGATGCGCTTGGTCAAGATCAGGAGGAGGAGGAATCTGCATCTACATCAGACAATGAGAGCACTGCTACTAGA
AGCAGAAGAAGCAGTGACGATAATGTCAGCTCTAGGGGTAGTCTTTCACCAATTCATGCTTTAGGCCCGGAATCGCATGG
GGCCGCAGATGCGGCACCACAGCTTCACGACCACAACCACAGAGCATTCAAAATACCTACGAGCCTAGAGAAGTGGAAAT
CTGATGCTGAGACTTCGTCAAAGGCAGTGAAAACAGCCGCAGGAACACGTCCGTCGTTGCCACCCGCCGCCTCGACCGCC
AGAATACAGGACGATATTTCGCTGTTTAAAAGCATCCAGTCGCGACATATCCAGCCAAAGCCGAGCACGACGATAAAATG
TCAGCTTCCAGAACCCGGACAGCTCCGCAAGGCAGCCAGGAGCTCGCGCAAGGTGCTTACGAAGCTGCAGAAAAAGAGGC
TGGCAGAAAGCAGGCTGGTCGAGCAGGCTGCGAAGAGGCTGCGAAGAGGAAAACGCGCATTGGAGGACGAGCAGGAGATA
GACGATGTCGATCTTGACCTGCCCGTACGAAAACCAGACAGCGAAGAAGTCCCTAAAGTAGCCACAAAAAAGAAGACATC
AGTAGCAGCCGTACCCGCCGCCAAACGGCCACCGCCATTTGAAAAGGACCGCATTGTCATTCAATACACAGTATTCCGCA
CTCAGCGCCTGCCGGCGTCCTTTGACGGCAACCTGATGGGAAAAATCATTCGCGGAAAGGCCTTTGCGGACAAAAACGAG
GCGAACCAGCACGCGGCAAGTATGATACCCCGGGCTGGGCCATCGGTGACCCGAATTGAGCTAGACTACGGAGCGCAGGA
CGAGGAACGTGACGGTATGTTCTTCGGGCGGGTGCACTACAGGAGCGGCGAAGTGGTGTTTGTGTATGTGGAGCGCGAGA
CACAGCAGTTTGGTAACATGGACCCTGCCGAGTACAACGAACGGCCGATCAACTCTGAGTACAGGGACCTGGTGCTTCTA
CCACGATACGACGTCTTCGTTTTCAAGCGCAAAGCCCTGGATTCCCAGGATGGAGGCTATGTGGTATATGAATATGACGA
AGACGAGCCCGAACAGAAGGAAAAGGTGCGAGAAAAAGGACCTGATGAAGAGGACGACAGCGATAGCGACGACGATAAGA
GCGACGACGTTGAGACCGACAACGAGGCTGCGACGAAGAAAAAGCCTAACAGCAGGCAGCAAGTCCAAAGAGACGGCGAC
ATAGCCGATGTGGATTCTGTAGGCAGCACAGCCAACAGTACCCAGGTGGTCCGACCTGCTATAGCTGAAGAACCGGCTGC
CTCCCTCCCCAGCACTCATTTTGTGCCTATTTATGAGGGATCTTTCAGCACCGTGACCGCAGCTAATTCGCAGGCCGTTG
ACGCTTTCTCTCGATGGACACGGCCACAGCCTCCGGCGCGTCTGGACGCTCTGATGTACTATCGGGACGTGCTGCAGCCG
TACATTGTGGAACTGCGACAACAGCTGGTGGGACGCAGCAACAGCGCCGACGGCAGTTCTGAAGACAGTGAATTTCTAGG
CGAAAACTGCGCTGAGATCTCGTGGGAGCCAGGACCACAACTGCGGTACGACTATGAGGAGATCAGCGTGGTTGTGGTGC
GCAGCCAACTGGAAGGACCGCTAGACCTGACCGGAGCGTTTCGAGGACCAGAAGGGAGGGCAGTCGAAAGATCCGCAAGT
ATTCTGGTCGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62