GenePrediction:GLEAN_1116 Details

Name: GLEAN_1116
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:661769..663071 (+ strand)
Length: 1303
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:661769..661826 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_173:661882..662192 (+ strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_173:662259..663071 (+ strand)
Length: 813
>GLEAN_1116 class=GenePrediction position=GCSC_173:661769..663071 (+ strand)
ATGCATGTCTCAAGCGTGCTTATGGCCCTGGCTGGCCTCAGCTCCCTGGCGACTGCTGGTGAGTACGATCTTGTTGGGGT
TCTAAATCTTACTGCTCACTAATATAATGACAGCACCTGCTACTGTCGACCGGAGGACATCTATTAAGCGCCATGTCGTG
GGTCGGCCTCTGAAAGCTACGAAAAACAACGGGGGCAACAGCAGCAATGGTAACAGCGGGAACACTATTGTCATTGAGCA
GACGATCATTGAGCCCACCGTGGTCATCGTCCAAGAGAACCTGAACCTCGTCACCGAGCTGGCCCTGATTGCCGAGCAAG
AATTCTCAGCCCTTGTACAGGCCCAGCTGGCTCTGGTCCAGGAGATTGGGATCATAAAGAACAACATTCGCGTCAACCAC
TTTTTCGCAAAGTTTTCAGAGGTGGTACGTATTCAGAGTTTTCACCTTTCCCTCAAACTCATACGCTTCTTCATTCTCAC
ACTCCTCCAGAACACTGTCATCATCGTCATCACTGAAGTCGTCGACGTTCGTAGCAAAGGTGGCTCCAACACACGCTACA
TGGTCAACCAGCAGCTTGCCAACCACAAGGGTTCTCAGAGCACCGTCGTTGTCATGATGACTGCCGCCAGTCCCATGACC
ATAGGCTTACCAACAGCGAGCCTCAATCTTTCAGCACTACCGTCTGGGTTCTCTGCTTCTGTCGTATCTGATGCCGCAGC
GAGAACCACGGCTGATGCTGCGTCCGCCGCTGCCAACACGGCTGCCTTTTCCAACACGACAGTCGGTAGCAGCAAGAGCA
AAGGCAATTCGTCGTCTTCAGGACAGGTGACCTCTTTCGACCCCAGCAACCCATTTGGCAAATTCAACCAGAGCATCATC
CTGCCCTATGGCTCTAAGGCGCCGAGTCTGCCTAACGGCGCCCAGATCGTCTCTGACCCAGCTGCTATCATCCTGCCGAA
TCAGGGTAGCCTCCTAGTCGAGGATGTCAACCGGTTCAGCCAGGACTGTGCCGTGCTTGAAAGCACCCAGACGCTTTTTA
CACTGCAGTCGGCCGAGCTGCAGGCCGAGCAGATCGCTGCGCAGCTGCTTAGTGGACTGTCGCTGGGAAAATCATCCAGC
CTCAACGCCGCAGCTGCAGCCCTGCTAGGTATCGCGGACGCTATCTCTGCACCCGATGTAGCTTCCGTCACTTCTTCTAG
CAGAGTTATTGTGTCTGCAACCGCAGCAGCAAGTTCAACGACCACCTCCGTCTCTACGCCAGCCGTTGCCACATCGACCG
CACTGCCTACTGCCACAGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62