GenePrediction:GLEAN_1117 Details

Name: GLEAN_1117
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:663917..664856 (+ strand)
Length: 940
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:663917..663941 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_173:664050..664063 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_173:664181..664229 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_173:664318..664399 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_173:664466..664544 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_173:664635..664856 (+ strand)
Length: 222
>GLEAN_1117 class=GenePrediction position=GCSC_173:663917..664856 (+ strand)
ATGTCTCTTGTTTCAGGAGAAAAGAGTGCGTACTAATTCCCATTGCTTGCTTGCATTCGTCCTGTCTTCCCCGAAAAGGC
GACAGTGGTGGTGGGTGAAGATGGAAAATCTCAGTACTAACTTTCGCAACCAGACAACTTCCAGTTCGTACGTTGAGACA
TCACATTGAAAGCTGCCGCCGCTTTCTCCGAACCCATCGATTATGCCAATGGCGCATGAAATCAGCCGCACGACGAGGCC
AGACTTGCTAACTGGAGGAAATAGATCATCCGTCTGTTGAACACGAACATCGATGGCAAGCAGAAGGTCGTCTGTTAGTA
CAATCCACCCGGCTTTTCTTCGCTCGCTAAGAGCGCACTGCTACGGCGGAGGGATACAGAAGGACTGACACACCATCACA
GACGCCCTGACCAAGGTCAAGGGTTGCGGTCGCCGTTATGCCAACATCGTTGCTAAGAAGGCCGATATCGACCTGAACCT
CCGGTACGTCGAGTCTGCGAAGCAGGATGAGTCAATTTGATGGGAAAGCCTGACTGACTCTTCGAATAGCGCTGGTGAGC
TCACTGCTGAGCAGCTTGAGCGGATAGTCAGCATCCTCCAGTCCCCCACGCAGTACAAGATCCCCTCCGTACGTTTTTGC
TCAATTTGTGGACTCATTTAATGTGGCCGAATCGATTCGGTCAGTTGGTGATGGCAATGCTAACAGTCGCCGGCATAGTG
GTTCCTTAATCGTCAGCGCGATATCGTCGACGGCAAGGACTCGCAGATCTTGGCCAACGGTGTCGACTCCAAGCTCCGCG
AGGATCTCGAGCGCCTCAAGAAGATCCGCTCCCACCGTGGTCTCCGTCACTACTGGGGCCTGCGCGTGCGCGGTCAGCAC
ACCAAGACGACCGGTCGTCGCGGCCGGACTGTCGGTGTGTCCAAGAAGAAGGGTGGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62