GenePrediction:GLEAN_1118 Details

Name: GLEAN_1118
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:667641..669384 (+ strand)
Length: 1744
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:667641..668124 (+ strand)
Length: 484
Type: CDS
Source: GLEAN
Position: GCSC_173:668189..669384 (+ strand)
Length: 1196
>GLEAN_1118 class=GenePrediction position=GCSC_173:667641..669384 (+ strand)
ATGCGCATTGCCGCTTCGGCCGTCATTGTGGGCGCCGCTTCGGCCTCGCTGCTGTCTCCGCCTGGCCAGCAGCAGGTGTT
GGGCAATGCTGAAAAGCTTGCCCCCGTCGACGATACCGTGCCTTCGAGCTCATCTGACCTGCTTTCCTCGCTCCAGGGCA
TCCTAAAGGGCTTGACGCCCGATGCCGAGGCCCTCTGGGAGGATGTCCGGAAGCTGGTGCCTGATGCCTTTGAAAAGGCC
AGCCTCTTTTCCAACCCGAAGAAGCACACCCGTCGTCCCGATAACCACTGGGACTTTATCGTCAAGGGTTCTGATGTCCC
TGCTCCTCTGACCGCGGCCGCCCCCGGTTACGAGGACAGCGGTGACATGAACGCCTACAACCTGCGTGTCAAGGCTGTCG
ATCCGTCCAAGCTTGGTATCGACAAGGTGAAGCAGTACAGCGGCTACTTGGACGACGACGAGAATGACAAGCATCTGTTT
TACTGTGAGTTGGCGACATCCCGTTTCGCTGTCTTGTACCTTGTCCAGCTCTCGTACTAACCGATCAGGGTTCTTCGAGT
CCCGGAATGACCCCAAGAACGATCCGGTGGTCCTTTGGCTGAACGGCGGCCCGGGCTGCTCTTCGCTGACTGGCCTTTTC
TTCGAGCTCGGCCCCTCGGCCATTGACGAGAACATCAAGGTTGTCAACAACCCGTTTTCGTGGAATGCCAACGCTTCCGT
CATCTTCCTCGACCAGCCTGTCAACGTGGGCTACTCCTACTCCGGCACGTCCGTCAGCAACACCGTCGCTGCCGGCAAGG
ATGTCTATGCACTCCTTACCCTCTTCTTCAAGCAGTTTCCCCAGTATGCCAAGCAGGACTTCCACATTGCTGGCGAGTCG
TACGCCGGCCACTACATTCCTGTCTTTGCCCACGAGATCCTGGCGCACAAGGACCGCAACATCAATCTAAAGTCCGTGCT
CATTGGCAACGGCCTGACTGACCCTCTCACCCAGTACGAGCAGTACCGTCCCATGGCTTGCGGTGAAGGTGGCTGGCCAG
CCGTGCTGGACGAGTCGCAGTGCCAGGCCATGGACAACTCGCTGCCACGCTGCCAGTCGCTCATCAGCAACTGCTACAAC
TCCAAGAGCGTGTGGAGCTGCGTGCCCGCCTCCATCTACTGTAACAATGCCATGATCGGCCCCTACCAGAGCACCGGCCA
GAATGTCTACGACATCCGTGGCCCTTGCAAGGACACCAGCAACCTTTGCTACCCGCAGATGGGCTGGATCGCCGACTACC
TCAACAAGGACGAGGTCAAGACCGCCGTCGGCGCTGAGGTCGACTCGTACGACAGCTGTGACTTTGACATTAACCGCAAC
TTCTTGCTCCAGGGCGATTGGATGCAGCCCTTCCACCGCCTCGTGCCCGACATCCTGGCCGAGATCCCCGTCCTCATCTA
CGCTGGCGATGCTGACTACATCTGCAACTGGCTGGGCAACCGTGCCTGGGCCGATGCGCTGGAGTGGAGCGGCCAGAAGG
CTTTTGGCAAGGCTTCGACTGAGGCGCTGAAGCTGTCCACCAGCTCTGCCAACGACGAGTCTGCGGCTGAGGGTAAGAAG
GTTGGCTACGGCACGGTCAAGGCCGCGAGCAACTTCACCTTCCTCCGCATCTACGATGCCGGCCACATGGTGCCATATGA
CCAGCCGGAGGCGTCCCTGGACTTCTTCAACCGCTGGTTGGGCGGCGAGTGGGTCGAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62