GenePrediction:GLEAN_1119 Details

Name: GLEAN_1119
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:674594..675150 (+ strand)
Length: 557
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:674594..674903 (+ strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_173:674957..675150 (+ strand)
Length: 194
>GLEAN_1119 class=GenePrediction position=GCSC_173:674594..675150 (+ strand)
ATGGCGATGAGGGCAAAAGGATGGTATGGTAGCAGACAGATTTGCAAGAGGCAGGAGCGGGAAATGGCGCACAACCCAAT
GGGAAAGAGCGAGGAGCAAGAGGCAAAAGAAGAGCCAGGGGTCTTGTTGCAAGGCGGCCAGAGAGGGGCGGGTGTGCAGA
GTGGTCGTTTCGCAGGAAGAAGGAGCGAAGGGATGGGTGAAGGAAAGAACGGGGTGAAAGGTGAGAAGGACGAAGGAGCG
AACGAGTACGACTATGGGATTATTACTGGGGCAGACGGGCTTCGAGAAGGGGAAAGGAACAAGCGGGAGGGTAGGTGGGG
GTGCCAAAAGAAGGGGTGTGCTTGCCACGTTCCCTACCTGCAGGCAAGTACGAGCATAGGGAGCAGGGAGCAGGAGCGAC
CGGCGGGCGGCAGCAACGGCGGGGACAGCGCGACAGCGACAGACGGCAAACGGCCAGGGCAGAGCAGAAAGTGCGCGCGC
GATCGGATGGGAGAGCTGTCAGGGCGCGCGCACGCAGCAGAGACCGGTGCTGGTTCTTTGTTCTGTTTTCGTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62