GenePrediction:GLEAN_111 Details

Name: GLEAN_111
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:767527..768385 (+ strand)
Length: 859
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:767527..767929 (+ strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_179:767982..768385 (+ strand)
Length: 404
>GLEAN_111 class=GenePrediction position=GCSC_179:767527..768385 (+ strand)
ATGAAGTTCTCTACCGTGCTTTCTGCCGCCCTTCTCGGCGCTTCCACCACTTTGGCTGCCCCGAGGCCGGCGGCCAACCG
CATCGGCAAGCGGTCGATCCAGAAGAAGTCCCTTCCCAAGATGTCGGCAGTTGGTGCCCACAACACCACCGCAGACGAGG
AGGAGAGCTACAACTGGTCTGGCGCCGTGCTGGTTGGCACTGGCTACACCTCCGTGACCGGGAAGATCGTCGTGCCCACC
ATCTCTTCGGGCTCGTCCAACAACGACAAGGTCGGCACGGCCTGGGTCGGCATCGACGGTGACACCTGCAGCTCGCTGTG
GCAGACGGGTGTCTCGTGGACCGTCGAGGACGGCTCGGTCGACTACACGGCCTGGTACGAGTGGGTTCCGTACAGCGCTT
CGGGTAAGTTTTCTGAGAGTATCATAGTGCGGAAGACAAGTACTGACAGCCCCAGTCGACTTCACCGGCATCACTATCTC
GGCCGGAGACAGCATCGTCATGACCGTCACGGCGACGAGCACGACGTCGGGCACGGCCACGATTGAGAACGAGACCACCG
GCAAGACGGTCAGCCACACGTACAGCTCCATGTCGAGCGATAACGCGCTCTGCTACTACAACGCCGAGTGGATTGTCGAG
GACTTTGCCGAGTGCCTCGACAGCAGCTGCACCCAGACTGAGCTGCTGCCGTTTGCCGACTACGGCAGCGTCGAGTTCAC
TGACTGCTCGGCCGTCAAGTCGGGCGCCACCGTCGACGTTACCGGCGCCACGACCATCGACATGGTCAGCCAGTCGGACG
ATTCGGTCGAGTCGAGCTGCACTGACACGGCCTCGACCGTCACCTGCAAGTACGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62