GenePrediction:GLEAN_1120 Details

Name: GLEAN_1120
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:694604..695247 (+ strand)
Length: 644
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:694604..694906 (+ strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_173:694963..695130 (+ strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_173:695185..695247 (+ strand)
Length: 63
>GLEAN_1120 class=GenePrediction position=GCSC_173:694604..695247 (+ strand)
ATGCTGTCGGCCTCGAGACGGAGCGTGCTGCAGCGGGGGCGCCTGGCCCTCGGCTCAGTCGCGGCCCAGCAGCAGAAGCA
GCAGCAGAAGCGGGCCTTTGCCATGACGACGCGCAAGGCGCAGGACGGCGCGGCAGCGGCGGCCCCGACGGAGACGCTGA
CACCGCAGACGACCGGTGCGTCCAAGAGCGACGTGACCCTGCAGCAGGCACCCAACCGGGCGGGCGTGTGGACGCGCAAC
CAGCGGCCACGCGAGCAGGCCATGACGGGCCCTCGCTTTGAGCAGACAGACTTTTCCCTGCAGGTGCGATGCGGAAGCGC
GAACGGATGCAGACATGGAGGCGATGCTAATGGTAACAGCCCCAACCGTACTCGGCCATGGAGCTCATCCACCAGCAGCC
GGTCCGGTGGACGCACGACAGCGTTGTGTCGTGTGATGGAGGCGGCGGTCCGGCCGGCCATCCGCGCATCTTTATCAACA
CAGACAAGCCACAGATCTGTGCCTGCGGCTACTGCGGGCTTCCTTTTGTGCGTCTTCTCGGCCGCGATCCCTTCTGGACG
TCCGTCTGCTAACTGTGCTAGGCCAACGAGCACCACCGGAAACACCTCGAGTCCCTGCCCCAGACGTCGTATCCGCTCGA
ATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62