GenePrediction:GLEAN_1121 Details

Name: GLEAN_1121
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:699769..703090 (+ strand)
Length: 3322
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:699769..702544 (+ strand)
Length: 2776
Type: CDS
Source: GLEAN
Position: GCSC_173:702654..703090 (+ strand)
Length: 437
>GLEAN_1121 class=GenePrediction position=GCSC_173:699769..703090 (+ strand)
ATGCCGACGCGAACATCCAAATCAGGCCGGTCGTCGGCAGCGGTCTCACACAAGACGTCGATGGCATCGCGAGCGTCGTC
GGTAACGAACGTGGACGTGCCTCCGGAGACGGAAGATAATGCACTGCGGGCCAAGGTGGTGCCAATATTTCGCGAAGCAC
AGAAGAACACAGCCTCGCACCGCAAGCTGGCGGTGACGCTGCGCAAAATGCAGGAAGCGTGCTGCTACGAGCCGACGAGT
GTGAGCCGACCATCGGCAGCGGCAGCAGGCTCAGCAGACTTCCACGAGGACGACTTCAACGCGGAGTTTGTGCGGTGCGT
GCTGCGGGTGATGCCGGTGCGCAAGGCCGAGCCGGTAGGCGACAAAGTGGTGCGGTTCGTGGGACTGTTTCTGCGTCTGG
CAATCGAGAAGGACAACGAGCTGCTGGGCGAGGTGGATGAGGATGCTAGCACCATGCCGGAGACACCGGGAACACGGCTG
ACGGGCGATCTGGTAGACCAGCTGCTGCCGCTGCTGGTGGCCAAGGACAAGTTTGTGCGGTACCGCTCGACACAGCTGGT
GGCACACATTGTCAACTCGCTGGACGCGATCGACGACGACCTATTCCAGAAGCTGCGGACGGGGCTGCTGCGGCGGATCC
GCGACAAGGAGGCGATGGTGCGGGCACAGGCAGTGCTAGGACTGGGCCGGCTGGCGGGCAACGCAGGCGAGGGCCCGGAA
GACTCGGACGACAGCGACGGCAACATGGCAACGTCGGGGCTGCTGGACAAGCTGCTAGAGGTGCTGCAGAACGACCCGAG
CGCTGACGTGCGGCGGTCGTTGCTGGTCAATCTGCCGATCTTGCCAAACACGCTGCCATATCTGCTGGAGCGGGCACGTG
ACGCAGACGCGGCGACGCGGCGAGCAGTATATGCGCGGCTGCTGCCGGCTCTGGGCGATTTCCGGCATCTGTCGCTGTCC
ATGCGCGAAAAGCTGCTGCGGTGGGGTCTGCGGGATCGTGACGAGAACGTGCGCAAGGCAGCAGGGCGGCTATTTCGCGA
GCGCTGGATCGAGGACTGTGCCGGGCTGCCGGCCGAGGAAGAGGGCGGACAGGCGACAGGAGCAACAAATACCAGTGTAG
ACGGACTGCTGGAGCTGCTGGAGCGAATCGACGTGGTCAACTCGGGCGGCGAGGACGGGGTGGCGCTAGAGGCGATGCGC
GGATTCTGGGAGGGTCGGCCAGACTATCGGGACGCGATGACGTTTGACGAAGCGTTCTGGGAGACGCTCTCGGCAGAGTC
CGTGTTCCTGGTGCGCAGCTTCAACGATTTCTGCCGCAGCGACGAGAGCGGCAAGTACGAGTACCTGGTGGAGGAGAAGC
TGCCGGAGGTGACGAAGCTGGCATTTTACCTGGAGCGGTACGTCAAGGTGCTGGTGGACGCGATCCGGCAGGCAGACGCA
AAAGAGGCCCAGGTGGACGAAGAGGAGGACGAGGAGGAAGACACGGTGGAGCAGGAGTTTATCGTGGAGCAGCTGCTGCA
CATTGCGCTCACGCTGGACTACTCGGACGAGGTGGGGCGACGTAAGATGTTTGCACTCCTGCGGCAGAGCCTGTCGACGC
CAGAGCTGCCAGACGAGGTGACACGACTGGCAGTGGACGTGCTGCGAGACATTTGCGCGCCAGACGCGGCGGGCGAGCGG
GAGTTCTGCAGCGTCGTGCTGGAGGCGGTGGCCGATGTGCACGACACCATCCTGGACGACGTGGACACGAACGAGGAGGC
GGCAGCCGAAGACGACAGCTTCCACTCGGCGCGATCGGAGGTGAGCGAGTCTGGGGGTGGAAATGGGAGTGGTAACAACA
AGGGCAACCATGGTGGGACTGGGAATGGAAAGACCAACAGCAACAAAGCCAAAGAGCCCCCTACCGAAGAAGAAGTGCAG
GCCAAGGCGATCAAGGAGATTATGATCAACATGAAGTGTCTGCACATTGTGCAGTGCATGCTGTCGAACGTGTCGGGCAG
CCTGCAGAAGAACGACCACCTGGTGGCGATGCTGAACAACCTGGTGGTGCCGGCAGTGCGCAGTCACGAGGCACCAGTGC
GAGAGCGCGGGCTGGTGTGTCTGGGGCTGTGCGCGCTGCTGGACCGATCGCTGGCAGAGGAGAACCTGGACGTGTTTATG
CGCTTCTACAGCAAGGGCCACACGGCACTGCAGATGACAGCGCTGCAGATCCTGACGGACATGTTGAACGTACACGGGGC
CCAGCTGCTGTCGACGAGTGCGGCGCTGCTGCGGATGTACGTGCGGGCGTTACGATCGGGTGCGCGGGCGCCCGAGGTGC
AGGCGACGGCCGTCGTGGCCGTGTCGAAGCTGCTGCTCGGACGCGTGGTCACAGAGCCAGACGTGGCGGCTGAGCTGCTC
CGGACGCTCGTCGTCGCCTATTTTGAGCCGGCCAGCGCCGGCAATCAAGGCGTGCGTCAGGCTCTCAACTACTTTCTGCC
TGTCTTTTGCTTCTCGCGGCCCGAAAACCAGGCCCTGATGCAGGCCGTCGCTCCGGATGCCCTGCACGCCCTCTTCAACG
TGCGTGAGGGCCTTGAGGACGACGATGCCGATGTCGGCACCGAGATGGTCAGCCTGGCCACTGTCGGCGCCTGTCTGGTC
GACTGGACAGATCCACGCAAGTGCTACAGTCCCGACAGCATCACCGTCGATGGGATTGAGCGAAAGAATGTCAACGGCGA
CGTCCATCTGGACTTTGCGGCCGCCATCATGGAGCGGCTGCACGGGAACGCGAGCAGTGAGTTTGGGGGTTTATTTTTTT
TCTTGTTCTTTTCTTTTTCTTTTTCCTTTTCCTTTTTCCCCTTTTCCTTCTTCCTCTCATACTGACTCCTCTCCCAATTG
CCCAGAAGAAGAAAAGAAAATACTCGCTCCCCTCCTCGGAAAACTCTACATCTCTCCGACCTCCTCCGAAGACAAGATTC
GTACCCTCTACGAAGACGTGTCCGAGGCCGTCGACAGCCAGCTGCTCGCCGACGCCACCAGCCGCAACGCCCTCTACAAG
ATCCACGTCAGCCTCGGCAAGATCGTCAACGGACTCGACCAGGCTGCCGCCGGCTCCATCGCCGCCCGTCGCAGCACCAG
CCGGTCTACGTCGCTCGGCCCCGATGACCGCGACCGCGACCGCGACCGCGATCATGACCGTACCGTCGTCGTCGAGCCGC
GCATCAATGAGGAGGACGAGGCTGAGTCCGAGCTCGACGACGACGATGCCGCCAACCAGACTGCCCAGACCGTCGTGCTC
GCAGATGATGACTCGCTCGTGGATGACCTACTGGATGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62