GenePrediction:GLEAN_1122 Details

Name: GLEAN_1122
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:707405..709311 (+ strand)
Length: 1907
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:707405..707543 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_173:707628..707909 (+ strand)
Length: 282
Type: CDS
Source: GLEAN
Position: GCSC_173:707967..708035 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_173:708102..708412 (+ strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_173:708483..708585 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_173:708637..708862 (+ strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_173:708915..709311 (+ strand)
Length: 397
>GLEAN_1122 class=GenePrediction position=GCSC_173:707405..709311 (+ strand)
ATGGCGGCCCAAGAAGACATCGACAAGCTGGTCAGCACAATCCAGTCGCTCAAGAACAGAGACCTTGTCCAGATCTGCGT
GGCCAACCACCTGGCCAAGTCGGGCAATAAGGCCGACCTGCAGAAGAGAATCGTTAACTGTACGTGATCAGTCCACGTCG
CGCCATCCGGGCTCTCTCGCCCAAACGTACCCGCTCCAAGCTGATGTCCTCTTCCGTCTACAGTGATCGACGCGGCCTTC
CAGGATCCGAACCCCCAGAAATTCGTCGACATCCAGTCGAGCATATTGGCATTTGGCCGCGGGAGCTCCTCGGTCAATTA
TCGCGTGCCCAACTTTGCCTCCTCGCTACCGTCGTCACCGTCGTATCTCCCCTCCGGCATGTCGTCTCCCTACAGCGGCA
ACAGCACGACCAACGGCAATGTCCTACACCGGAGTGGCGGCTATGGCGGAAGCGCTGGTTATGGTGGCGAGCTTGGCCAA
CGACTGCCGCCGAATGGCCTTCTCGGTGAGCGGCATGCATCCCTTGTCACGCGAGTCCGGCCTGGCTAACCGTAATGCGC
AGGCCTGCAGTTCAAGCCAAGCCCGTTCTACGAGATCGACACCCAACTAGGCGACGTCCGGCCATGCGAAGGTGCGTTCG
CGTCCGAAAAGCCCTGGGCGCATATGCCGTCGCATCGTCGTCGCTAACGGCCTCCAGCCATGGCACAACATAGGAACAGT
GTCCCCGTCCAGATCCGGGTCTCGTCGTATCCCGCACTGCAGCGCTGTCTGGTAGACCAGTCGCTGCGCGTGATGATCTT
TTGTGCGGCCAGCAACGTTGGCGTCCAGGAGATCGCCTTTCCTTACCAATGCGAAATCAAGGTCAATGGCGGCGAGGTCA
AGGCAAACCTCCGGGGACTCAAGAACAAGCCTGGCTCAACACGGCCTGTCGATATCACCAGCCTTTTGCGCCTGAAGCCG
TCCAACTACAACAACACGCTCGACTTTACATACGCCCTGACCGCCAAGGTAAGCAGACTCCTCGCCTCCACAGCGCTGCC
CAAAATCGATGCTCACAGCAGACACTCTCTTCGCACAGCGATTCTACCTTGCACTGTATATTTGCAAGGCGCACACGGCC
TCGGAGCTCACGCGCGTGATTGAGCGGAGACGCATCACCAAAGACTCGGTCATTCGAGAAGGTGGGCCTACCTCCCATGG
CAGCTCTTTGTTCCTTGCTGACAGCCGCACAGTGACAAGGCAGGCGCAGGACCCCGATGTTGTCGCCACGTCACAGGTCC
TCTCTCTGAAGTGTCCGTTGACATACATGCGCCTGTCGCTGCCGATCCGGTCAATGACCTGCAAGCACATACAGTGCTTC
GATGCCACGTCCTACCTACAACTGCAAGAGCAGGGACCTCAATGGCTGTGTCCCGTGTGCAGCCGCACCGCCTCCTTTGA
TACCCTGGCGGTGGACGAGTATGTCACATCTGTTCGGGAAGATAACGCACCAGAAGCTGACAGCCGTTAGATACGTCAAG
GAAATACTGGCCAAAACGCCGAGTGACCAAGACCAGGTCACCATCGATCCGGACGGAACATGGCACGCCGAAAAACCCAA
GAACGGCAATGCACCATCCACGCCAAAGGAGGCTGCCACCAGCTTGCTTGACGAAGACGAGTCGATCTTCCCGTTCAGCG
GCCTGAGCGCCAGCGAAGTGCGCGAGAGCATGGGCCGGGCTAGCACGGCTTCGGTGGTCGCTTACAGGGACGCGACGGCC
ACACCGGTCCATGCCGGCAGCAAGCGACAACGCGAGGTGATCGACCTGACGCTCAGCGATGATGACGAAGACGCCCATCT
ACCGCCAGTGAAGCGGCAACACATTGCCAGCAGCGGGTTTTCGCCTATCCCTTACTCGACTTTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62