GenePrediction:GLEAN_1123 Details

Name: GLEAN_1123
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:710074..711030 (+ strand)
Length: 957
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:710074..710498 (+ strand)
Length: 425
Type: CDS
Source: GLEAN
Position: GCSC_173:710561..710678 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_173:710754..710843 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_173:710899..711030 (+ strand)
Length: 132
>GLEAN_1123 class=GenePrediction position=GCSC_173:710074..711030 (+ strand)
ATGTCGTTTGACACCATCATGCCGCCCTACAACGCGTCCGATCCGTCGGCGACGTTCCTCAGCTCAGCCTGTCTGGACTT
TCTCTTCATCGAGCTCGTCCCCATGGCCTACCGGGTCACCAACGAGCTGCAGGCAGACGCGCAAGCCCGCTCGCTGGCCG
TGGCCGCCGCCGTCGCCGGCATTCCGGGTGCAGGACCGCCACCAAGAGGCTCGATGGCGGCTTCAGTCAGCGCTGCCAGG
GGCTCGTCCACGGCTGCTGCTGCTGCTGGCGGCGCCAGTCTGAGCGAGGCCGGCCGCACTGCCGGCTCCGGCTCACTGAG
CGGTGCCGGCTCCCGTCGGGTGCTCGACGACGACGAGGAACAGGACGCGGTGTCGTTCCGGCTAGACATGCTGGGCTATC
GCGTAGGCCAGGGACTGGTCGAACGGTAAGCCGGAGAGCGGGAGCGAGGAGAGACGAATCTGACACGTTCTTCCGCCCGA
CGTCCAGGTTCTCGCGCGAACGCCCGCCATTTCACGACACCCTGGATGTCATCAAGTTTCTCTGCAAGGATCTCTGGACC
CTTGTCTTCCGCAAACAAGTGGACAACCTCAAGACAAACCACAGGGTATTGCTCCCCTCCTGTTCTCCCTTCTCCAACAC
AATCTGCTCGTGTTGGTGCTGACAGCCGCTCGCCACATAGGGAGTCTATGTCCTGACCGACAACGCCTTCCGGCCGTTTC
AGCGGATGAGCACGGAGACTGGCGGACAGGCCGTCGTCAAGGCACAACCGGTATGACAGGGACCCGCTCTCAGCCCCTAT
AAACTCATGTGCTGACACATCACAGTTCCTCTGGTTTCCCTGTGGGATCGTGCGCGGCGCTCTGGCGGCGCTAGGCATCA
CCGCCACTGTACAGGCCGAGAGCAACGAGCTCCCAGGGGCCATCTTCCAGATCAAAACAGTGCCTACAAAGGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62