GenePrediction:GLEAN_1127 Details

Name: GLEAN_1127
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:726443..728490 (+ strand)
Length: 2048
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:726443..726581 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_173:726694..726775 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_173:726852..728190 (+ strand)
Length: 1339
Type: CDS
Source: GLEAN
Position: GCSC_173:728260..728490 (+ strand)
Length: 231
>GLEAN_1127 class=GenePrediction position=GCSC_173:726443..728490 (+ strand)
ATGTCTATGTACGGTGGCCATCGCGGGATGGGCGCTGTCCCTCCCAGCAATGGAGGTGGTCGTCTCAATGAGCTCCTCGA
CCAGATTCGCTCCGAGTTTGAATCTCAGATGCGCGCCAGTGAGAACTACGAGCATCAGAGTGAGTCCATCTCCCATCTCT
CGTATCTCTGCCTCTTTTATCGATTTTATACTTTCCCCCAAAGCTTGAACTTTTGTATGCCGACCGCAAGGCTAATAGCT
ATTCCTCACAGTCCAGCAACAGGTCAACGAGATGCAGCTCATCCGCGAAAAGGTCTACACCATGGAGCAGACGCACATCA
ACGTGAAGCAGAAGTGAGCACAGCTTGGCCTCTTGATCGACTAAGAGCCGTGGTACGTGACGTGACGGCTGACAGTTTTG
TTTGCATAGATACGAGGAAGAGATTGCCCTGCTTCGTCGCCAGCTCGGAGAACGTGGTGGTCCTCAAGGCCCCATGTCGG
GTCCGCCTCAGCACGGCGGCCCGCCACAGCCACCGAATCTCGGGATGGGAAATAATGTCTTCGCCGCTATCATGGCCGGC
CAGGGAGGCCAGTCTGGCCTTGCACCACCGCCGCCGCAGGACCAGCAACCTCCGCCACACCAGCTGCAGCAGCAGCCACC
TCCAGGCCTTCAGGGCCCTCCTCCTCCACCTCCACCATCTCAGCCATTTGGCCAGCAGCAATACGGCCAGCCTCCTGCAC
CGGGTGGCTTCCCGTCGCAGCCTCCTCCCAGCACGGCTTCGCCTGGTCCGGTTAAGCGCCCCATTGGCAGGCCGCCTGCG
GGTGGTCCAGCCACTCCTCAGATCAACACTCCAGTGCCATATCCTGGCCCGGGCCAGTCACCCCAGGTGGCGTCGCACCC
TACGCCCGATCACGCGCGCATGCAGATGGCTCCGGCCAACCACGGAAATAACGCTCTGGGCGACGTGGACCTGGAGCGCC
TGCCGGCACACTACAAAAAAACGCGGGATGACTGGTTTGTGATCTTCAACCAGCACGTGCCCCGTGTGCTGGACGTGGAT
CTGGTGCACACGCTGCAGCACGAGAGCGTTGTATGCTGCGTCCGCTTCAGCGCAGACGGCAAATACGTGGCGACGGGCTG
CAACCGCTCGGCACAGATCTACGACGTGCAGACGGGCGAGAAGCTCTGCGTGCTCCAGGACGACTCGGTGGACATCTCGG
GCGACCTCTACATTCGGAGCGTGTGCTTCAGTCCGGATGGCAAGTACCTCGCCACGGGTGCAGAGGACAAGCTTATCCGT
GTCTGGGACATCCAGTCGCGCACGATCCGGAACACGTTTGCAGGCCATGAACAGGACATTTACTCGCTCGACTTTGCACG
CGACGGCCGGACGATTGCGTCTGGAAGCGGCGACAGGACGGTACGCCTTTGGGACATTGAGACGGGCCAGAGCGTTCTCA
CTCTGACGATTGAGGATGGTGTGACGACGGTGGCCATCTCTCCGGACACGAAGTATGTTGCGGCCGGCTCGTTGGACAAG
AGCGTGCGCGTGTGGGACATCCAGCACGGCTATCTGGTGGAGCGGCTGGAGGGCCCGGATGGCCACAAAGACAGCGTCTA
TAGCGTTGCATTTTCACCGAACGGCAAGGACCTTGTCAGCGGCAGTCTGGACAAGACGATCAAGATGTGGGAGCTCGCGG
CCCCACGGGGGATTCCGAACCAGGGCCCTAAGGGTGGCCGCTGCGTGAAGACATTCGAGGGACACCGGGTACGTGGACAT
GTTCCTTGTTCTGCTTCTGCTTCTGCGTCTTCTGCTTCCCGCTAACAAGATAAACAGGACTTTGTGCTTTCCGTGGCGCT
CACGCCCGATGCCGCATGGGTCATGTCAGGCTCGAAGGACCGGGGCGTCCAGTTCTGGGATCCGCGCACAGGCAACACGC
AGCTCATGCTGCAGGGCCACAAGAACTCTGTCATCTCGGTGGCTCCCAGCCCGGCAGGCAGCTACTTTGCCACGGGTTCT
GGCGACATGCGCGCTCGCATCTGGTCATACAGCCGCTACCATGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62