GenePrediction:GLEAN_1129 Details

Name: GLEAN_1129
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:753122..754709 (+ strand)
Length: 1588
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:753122..753725 (+ strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_173:754531..754709 (+ strand)
Length: 179
>GLEAN_1129 class=GenePrediction position=GCSC_173:753122..754709 (+ strand)
ATGGCAATCTGTGCTAGTTCGGCTGAGACCACCTCGACCATCTCCACCACTCACAACACGGAGCAGCGGATCCCACAGAG
CATCGACCATATTCACAACAACTATGGAAGGTATCTGAAGGCAGACATCATGGCCCAAGATGCCTTCTATGCTCTGCAGG
AGCTCTTTGAATTTTCCGCCGCATCGATTGACCAGCTTATGACGCTTTTCAAGAATACCATCCAAAGCGTGCTGAAGCAA
CGAAACACGGAGACGGCATCCGAGCTCCTCTTGTTAAAGGCGCACGTAGACGAGTACAGGGACTACGTCAACGAGATGCT
AGAGATTGTCCGTGCCCGTGGCTGCCGGAGATGGCCCCGTGTAACGGAGAAGAGCCTGCGAGCAAAGGCAGACATCGCGG
CAGAGCAGCTAGAGGACCGATACCAGCGCCTTGCCCGACAATGTAGCCGCCTTTCAGATCACTGCGACAACAGTATATCG
ATTGCTATGAGCCTCACCGCCCAGAGACAGAGCGACGAAGCCATAAACCAGGGGAATAGGTTCGGAAAGCTGAGCGTCCT
TGCATACTTCTACATACCTGTCACACTTGCTGCGTCGTTCTATGGTATGAATTTTAAGGAACTCGGATCAGACCTCAGTA
TTCGGGCTTTTTTCGTCATGGCAGCATCGCTGCTCGTAGCCTCTGTCATTGCCTGGTATTTAGACATACAAGCCTTCGTC
CGGGCTTGCTGGAGGTGTCTGAAAATATTCTTTGCTGATCCAAAAAGGCGCTACGCCTAGGTGCAAATGCAAGCGTGGGT
ATCGTGAGCCCGCTTTGTACGGAGACAAGCTCAGGCTGCCCAGGGAGGTCTCTGCAGCACAGCGCAAGTAAAGGAGGGTA
GGCGGCGCAATGCTGACAAGAATATATTTTAAAACACGGCTTAAATGCGGTGACCGAATGCATAAAGGTATTGAGTACTT
GCACCCGCAAGCGTCTTGGCTCGCCTACGCGTCACGATCCTTCTATTGTGGCGTGTTTATTGCTTACGGCGTCTGCAACA
TGCATGGTTTTGTTTGCCGTTTTCGTGCATGTGCATCTGCATTTCTAGCGCCGGAGATTTTCTCTCTGAATACTTCGAAA
CGAGGATGATCGACGTCTATTTGCCCAGACATGGATGGATGCCTAGTACTTGCTCATGCTAATAAAGAGGCGGGCTTGCC
TCCTCCCAGATACTTAAAACCTGTTATCTTGTTGTTGCAAGCAAGCCTTGTCGTCGTCAATACCTCAACTGTCAGCCGAG
GACCTTAAACCAAAAAATGTAAGGTGTATTATCACTCTTACCCCATTCTTTTTTTATCTGTTGCTGACTTGACACAAGAC
AGCAAAATGGAAGACGGAACTAACACGTCTCACAACGCAATTCTTGCAGGTGTGGACGAGCTTCATAACTCGTCGTACTC
GAAGATTCAACCTTGGAAGCTTCCGACCGGAGGTATTCCGCCGCGCAACATGAGAACCATGGAGGAAGATAGCACGCATG
GCATTCCAAAGGGGAACAACCTGATCATGGGAAATGAGCCCGTCGGGTTGAAGTCGACCGAGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62