GenePrediction:GLEAN_112 Details

Name: GLEAN_112
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:770677..772473 (+ strand)
Length: 1797
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:770677..770795 (+ strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_179:770849..771292 (+ strand)
Length: 444
Type: CDS
Source: GLEAN
Position: GCSC_179:771375..772473 (+ strand)
Length: 1099
>GLEAN_112 class=GenePrediction position=GCSC_179:770677..772473 (+ strand)
ATGTCTTACAAAATTGCTGCACCGGACGAGTACCTTGCCATTACTGGCATGGGAATCGACAACATCAAAATCACAAAGGC
AGCATGGCTTTTTCCCTTTCAGAGATGCATGCGCTTTAGGTAGGTCGAAGGACTGTGTTTCTGTGTGTTGCATCCTCGCT
GACCATTATCAGTATCCGGCCCAGGGACTATGCCATGGATCTCCAGGCCATGACCAAGGAAAAGCTCCAGTTCCTCCTCC
CTGTTGTTTTCACCATCGGCCCTGATGTTTCGCACCGGACTGATCACGGCCAGAAGGTGGTGCAGCCGGAAGGCGTCGCC
GCGTCCGTCCACGGCGGCGAAGATGGTCCGCTCCACCCTCCTTCAAAGGAGGACACTCTGACCAAATACGCGATGCTTCT
CGCGGAGAACTCAGCCACAAAAGTCAAGCCTGAAAGCACATTTTTGGAAAACATCGTCAAGGGCATCATCGAGGGTGAGA
CCCGCGTGCTCGTTTCGAGCATGACGATGGAGGAGATCTTTACGGAACGCGAGATCTTCAAGCGGCACATCTTTCGCAAC
ATCCAAGGCGAGCTTTCGCAGCTGGGTCTGACAATACTCAATGCCAACGTGAAGGAGTGAGTTTCTTTCCTTCCCCCCCC
CAATTTTTTTTTGGTTTCTTTCCCTTTTTGTACTCTTCATCTCGCTGACACCGTGCAGGCTGAAGGATGCCCCAAACTCA
GTGTACTTTGCATCCCTGTCGCGCAAGGCCCACGAGGGTGCGGTGAACTCGGCCAGGATCGACGTGGCCGAGGCCCAGCT
GCGTGGCAACGTCGGCGAAGCCAAGCGCAAGGGTGAGCAGGAGCGCGAGCTGGCCAAGATCCACGCCGACACGGCAGTGC
AAAAGGTTGACCGCGACCTCGAGCGGGCGCAGGCCGAGGCGACACTGGCAACACGCAAGGCCGGACTGGACCGCGACGTC
GACATTGCACGCATCGAAGCTTCGCGCGCGACCGAGTCCAAGGACGAGGCGCTGAAGCGCGATGTCGAAATCAAGCGAGC
GGCTGCCGAGCTGGAACGTCTTCGCGCCACTGACGTCGTCAAGGCGAGCATCCGCCGCGAGTCCGAACAGCAGGCCGCCG
ATGCCAAGGCCTATGAGATTGCGGCCAACGCGCGGGCCAATCTGGAAAAGGGCCAGCGCGAGGCCGAGGCGTCAGCCTAC
CGGATGAAGGCCGGCGCCGACGCCAAGGCCTACGAGACGTCGACTACCGCGAAGGCCGACCTAGAAAAGGCCCAGCGCCA
CGCCGAGGCCGGCGCGTTCCAGATCCAGGCCGAGGCCGACGCTTACGCCTACGCGGTCGCCAAGAAGGCTGAGGCTCATC
AGAAGGCCAAGCTGCTCGAGGCCGATGGGCTGGCCGCCATGGCTGAGGCCTACCAGCATATGGCCGTTGCCTTTGGCGGC
CCGGCTGGCCTGCTGCGCTACATGATGCTCGAGAAGGGCACGTACGTGGATCTGGCCAAGGCCAATGCCGATGGCATCCG
CGGCCTGCAGCCCAAGATCAGCGTTTGGAACACCGGCGCCCAGGCCGGAATCGAGGGCGGCGGTGCTGGAGCTGGTGGTG
TCGGCGACGGGTCGGCCTCGGGTGCCGGCGGCGCCAGCATCGACACTTTGCGCAACGTCTACCAGATGCTGCCGCCGCTC
ATGACGACGATCCACGACCAGACTGGCATGACCTTGCCCGAGTGGCAATTCGGCCGGCTGGCCGGGGAGATGAGCGAATC
CAAACGGTCCAAGACGATCACAGTCAACAAGGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62