GenePrediction:GLEAN_1130 Details

Name: GLEAN_1130
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:756484..757373 (+ strand)
Length: 890
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:756484..756533 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_173:756584..756803 (+ strand)
Length: 220
Type: CDS
Source: GLEAN
Position: GCSC_173:757020..757373 (+ strand)
Length: 354
>GLEAN_1130 class=GenePrediction position=GCSC_173:756484..757373 (+ strand)
ATGCTTGTGCAGCCATATCCTGATCCTGGAACTGCAGAGCCGGGGGTAGAGTACGTAGATGTGTCTAGATCAGGCCGGGA
ACCAAGCTCACATGGGACAGCTTTGTCGTCATTCCAGGGATCTGGAACGAGAACACGCCAGGTAGAGTGAAGGGCAGCTG
TGCTTGGGTCAAGCCCCTTGAGGAATCTGCAGCTGGAAACGTCCGGGTGTTCTTGTTCGTCTACCAGCTGGAAGTGGATG
GGTCTTCTCTTTGGGATCAACTTCTGAATCAGAGCTCGGCCCTGCTCTCAGGTCTGGAGGAGCACCGCTCCGTTCCCACA
GTACGGCATCAACGGCATGATGCACAGGTTTTGGAGTTGTGAGGCTGACAGGGAACACAGCTCAACCAGAGGCCGATCCT
GTTCATATGTCATAGTCTTGGTGGCTTGGTGCTGAAAAAGGTGGGCGTCCGTCGGTTCTTTCGGTTCTTGATCTGGGCAG
CCAAGGGAAGCATGCCGATTAGGCTGACCACATACCCGAGCTAGGCTCTAACTCAGCACGGTAGCTTGCGTCAAGCATAC
CAAGATGCCACGGCCGGGATAATATTCTTGGGCACTCCGCACCTGGTCACCGACACGTGTGCTGGATGGGGGATATCCCG
GTCGCTAATGCGGGCGAGCCGGAGGGATATTGAGAAGGACAACATGGACGACTCGGAGCGGAAGAGCATCATCACCACGT
GTCAGAAATTTGAAGGCGTCTATCTCGACACACCGATACTGTCTGTTTACGAGCAGCGAGAGACAAAGGCTTCGTGGCAC
CTGCGCAAGGTTCTGCTCTTTAAGAATTCGAGGGTCGAGACGGAAATGGCGAGTAGTATCGCTGATTCTGACAATGCTTT
TATGTCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62