GenePrediction:GLEAN_1131 Details

Name: GLEAN_1131
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:757408..760212 (+ strand)
Length: 2805
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:757408..759659 (+ strand)
Length: 2252
Type: CDS
Source: GLEAN
Position: GCSC_173:759718..759909 (+ strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_173:759972..760212 (+ strand)
Length: 241
>GLEAN_1131 class=GenePrediction position=GCSC_173:757408..760212 (+ strand)
ATGGTGAAAATCGACACCAAGGGCGAAACCCTTTTCGGGGCAGATAAAGACCACATGGGCCTATGCGACATAGACGAGGG
CGAGCCACTGTACGGTAGAGTGGTCGAGTTCTTCTCTGCCTTTGTCCAGCAGGCACCCAAGGCAGTCGAGGTCGCCCTTC
GTCCGGCGGCCGCACAGACGGTCCGATACGCAAACGCAAATTTGAGAACAAGAAGCAGCGTCAGCTCGTTCGCTATGAAG
TCGTCGGGACAAAACGAGCCTGCGATCTATACTCCTGAGAGCACGCTGAGCAACGTCACCAGCCAGGCCCCTCTGGACCT
AGAGACGGGCGCGGGCGAGATACTGGAGCAGCAGGTACGACTCCCGTTCTCGCACACCGGGTCCGTCACGAGGAACAGAA
ACTTCTACGGCAGAATAGCCGAACTTGAGGCCATAGACTGTGCGTTTGGCTTGACGCCCCGTCCAGCACAAGAAGAAGAC
GAAGAGGCAGAGGGTTTTGCCACGCCAAAGACATATGCCCTGAGCGGCATGGCGGGCATTGGAAAGACAGAAATTGCCAT
CGAGTATCTGTATTCGCGACGCGATCGCTTCGATGCCGTCATCTGGCTCTATGCCGACACGGCGCAGAAGATGGGGGCTC
AGTTTTCGGTGCTGGCCAAGGAGCTAAGTCACGTGCCAGTGCCAGACAGCGTGGACGACGTATCGGCGCGAGACATTGTC
CGAGGCTGGTTGGCCGCACCAGCAGGTCATCGCAACGAGCACGGCCAGGCAGTGCAGGCGGATGTGGGCACATGGCTTAT
GGTGCTTGACAATGCGGAGCAGCCGGATGTGCTGTACGAGTGGCTGCCCGACCAGGGACCGGGCTGCATCCTAGTGACGA
GCCGGATCCCGTATGTGAAGGAGGGTGCGTACCGGCTGCAGCGCGGCCAGCACCTCGAGCCGTTTGCGCCGTCGGTCGGC
GGCCTCATGTTGAGCGAGCTGTCCGGACGAGGGGGGGAGGCGGGCGCGGTCGACGCCAGCAGGCGCATCTCGGACGTGCT
GGGCGGCGTGCCACAGGCGCTGTTTCTGATGAGCGCCTGCATTCGGGAGCACCAGCTGACGCTGGCCGACTTTGAGCAGT
GGTATGAGCATGATCCCGGCCAGCTGCACGGCTTCCGGGCGTCGATGGCGGGCCCACAAACGGCACACGGATCCACGATC
GCGACGGCGTGGGCCATCGAAAAGCTCGGAAAGTCAACCGTAGCGCTGCTCCGGCTGCTCTCCGTGCTGGACCCAGACCG
GATCTCGGAATCCATGCTGCGCGGCACCGAGACCGAGCCCGCCAGCGCCGAGCTGGACGTGCTGCCTCCCGACTACCCGC
GACAGGCAGCCGGCTATTTTGCCGCCCGGAGCGAGCTTCTGCGCGCGTCGCTGGTCGTGCGGAACATGGCAACAGGCGAG
CTGCGCGCACACCGGCTCGTGCTGGACGTGGTCCGCCTCCAGATGGACCACAACATGCTGTATTCTACCTGCGCGGCCGC
GGCCGTGCTGCTGTCGAGGGCCTGGCCATACGTCTCGGGCACGGATCCCGACCGCAACCAAGCCTGGCGGGTGCCCGAGG
CTGAACGGTATGCACCGCACATCTGCCGGCTGGAGGCGCTCTTGGGCCAGGCTATTCGCGACGGCAGATACAACGGGACC
GCCACCATCGGTCGCCTCCTCTGCAGCTATGGATGGCACATGACCGAGCGCGGCGCCCCTGCCCGGACGGAAGCGCTCTC
GTCTCTTGCCCAGCGCATTCTCCAAAAGGCCGTGGCCGGTGGCCGAGCCGGTGATGAGGACGAAGACGAGGACGAGGAGC
GAACCACACACTGGCTGGGCGAGGCACACCACAACCTGTCGCTCGCGGCTTGCCACACCGGCTCCTCTTCCGGGGCACGA
GACGCAGAGATATGGCAGGACATCTTGCGCGGTCGCATCGCCAAGTACGGCCGGCCGGCCGACCAGCTCGCCCTGGCTAC
AGCACACAACCAGATGGGTATCTGCCTCGCCCGGCAGGACCGGTACGAGGATGCCCTCCGCAGCTTCCAGCTAAGCCTGG
CAGGCTTTCGCGCCTGCACGGATCCTCCGCGCTTCAGCGGCACTTTTCCCGCTATATCAATCTCCCTCCTCTGCCTGCTG
CTGCGAAGACCCGGCCAGGCCGAGCACTACTTGATGCCCACCCTTCTCGAGCACGAGCGGCATCTCGGCCCGGACGACAC
CACCACTACAGAGTAGGTACCCGACTCCTCCCAGAGACCGCTCCCGGGCCCGTGCTGACAATGCTCCCAGGTCGGGGCAC
ATCTGGCGTGCCATGGGACACATCCGCAGAGGACAGCACCGTTTTACCGAAGCCCTCCGGTACCACGAGCGCGCGCTCAC
CAACATTCGCGCAATCGTTGGCGACAAGCACCACTTCTCTGGTGACTCCTTCTACAGCGTTGCCGAGGATCTGATGCAGA
TAGGCGATCTGCCGGTAGCAATGTACTCAGCAGGATTCCTTGCACCAAGAAATACGCTTACTAATCACTGTCGTTGCCCT
GCAGACAGAACCTAGACTGTGCCATCGAGGCGTTCACGGCCGGGCCGCACAGGGACGCGCAAGCCGCTCGCGCGTTATGG
ACAAAGGGCCGTGCCCTCAGAATGATGGGCAACGAGCAGGACAGCGGACAGCTCTTCCGGGAAGCCATAGAACGGAGACA
CAAGCTTGTCCCCGGCGACAGGCGTTCGATAAATGAGCTGTCGGACAACGACTGGACGAGTCTGGTCTTCTACTGGTCTC
GCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62