GenePrediction:GLEAN_1132 Details

Name: GLEAN_1132
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:762116..763006 (+ strand)
Length: 891
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:762116..762140 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_173:762457..762509 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_173:762568..762860 (+ strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_173:762919..763006 (+ strand)
Length: 88
>GLEAN_1132 class=GenePrediction position=GCSC_173:762116..763006 (+ strand)
ATGGCACCGAAGGAGATAAAGAAAGGTATATAATTGAAATGACGGGGACCAAACCGTCCTCTTAACGTCGACTCCCGCCA
TGTGAAATCAACTCCAAACGAAAGCTCTGCATCGGTTCCCCTCCTACCGACTTGTCGCACACGTTTTTTCTGTTGAACTT
CAGGTCCTTTGCCGGATATGGAGTGAAAATCGAGAGTCGTCAGAGGCATCGGTTGGAGGGGAGGGAAGGGGAAGGGAGAT
CGCAAACTATACTGCACTTCCTTCCTCTGCGTCCACAGCAGCAGCAGATTTTGCGAGTTCTGTTCCAAGAGCGATTGCTG
ATTGCGGTTTGTTGTTCATAGCGTCGAAGGGCACCAAGAAGGCCACTGCTGCCTCCAAGGCCGCCCTCAAGGGTGTACGT
TGCCTCTCTACTTCCCACCGTTCGAAAGCTCAAATTGCTAACAACATTGCAGGTGCACGCCCACAAGGCCCAGAAGGCCC
GGTACACGACCAGCTTCCACCGTCCCAAGACCCTGCAGCTGTCTCGCGCGCCCAAGTACCCGCGCAAGTCCATCCCCCAC
GCACCGCGTCTGGACGAGCACAAGGTCATCGTGCACCCGCTCAACACCGAGAGCGCCATGAAGAAGATTGAGGAGAACAA
CACCCTCGTCTTCATTGTCGACATCAAGGCGAACAAGGCCCAGATCAAGCTGGCCCTGAAGAAGCTGTACGACATTGATG
TCGTCAAGATCAACACTCTGATTCGGTAAGAACTCTTTCAGGTCGCTGAGGCTACAAAAGGATGTGCTCTAACAAAACAA
TAGCCCCGACGGTACCAAGAAGGCATACGCCCGCCTGACGCCCGATGTCGATGCTCTCGACATTGCTGCTACCAAGCTGG
CGCTTGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62