GenePrediction:GLEAN_1135 Details

Name: GLEAN_1135
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:773575..778152 (+ strand)
Length: 4578
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:773575..774105 (+ strand)
Length: 531
Type: CDS
Source: GLEAN
Position: GCSC_173:774182..774364 (+ strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_173:774422..774603 (+ strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_173:774671..774782 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_173:774850..774910 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_173:774972..775120 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_173:775185..775375 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_173:775442..775682 (+ strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_173:775909..777231 (+ strand)
Length: 1323
Type: CDS
Source: GLEAN
Position: GCSC_173:777294..777980 (+ strand)
Length: 687
Type: CDS
Source: GLEAN
Position: GCSC_173:778141..778152 (+ strand)
Length: 12
>GLEAN_1135 class=GenePrediction position=GCSC_173:773575..778152 (+ strand)
ATGACGACTGCCGAATCTCCTTCTGCTCCTGGTGCTCCTGAAGAATCTCTGCTCAGTATGGACCGACGAGCGATGGAGGC
GGAGCGTCTGGCCCGACGCCAAAAGCAACTGGGCCAACAGCAGCAGAAGCAGGACCAGCCACACATTAACACGGCCGAGG
TGCAGCAAGGGAGTGTGACAGCGAAACGAAAAGCTGAAAGCGGGGTAGTGGTGATTGACGACGGCTCAGATGATGATGAC
CAGGGACCGCCAGCGAGAAGACGGAAGCTGGGGAGCAGTGTTGCTGCGTCTGCAGCCCCAGCTGCGGCAGATGAGCGACT
GCGCTTCCCCGAGGGCGTTGTTAAGAAAACGTGGATCCGGGGGCAGCCGCGAGGCGACGATGACATTACCATCGACGAGG
TCTGGCAGAAGAGCGGGCTGGAGCTGGCTGTTCTGAGCTCGTTCCAATGGGACGAGGAGTGGATGATGCAGCATGTCGAC
GTGCGCAAGACAAAGCTGCTGCTGATCGCCTATGCGGCAGACGAAAACCAGGTAGGTGCTGCCTGTAGGAGGGTATCAAT
GAGATCTATACGATGCTGACAAGAGCGTGTTCCACCCCTCTCTCAAGAAAGTCGAGATGCGCGAGAATGTGCCAAACAGC
AATGTCCGGTTCTGCTTCCCACCGATGCTTTCCGTGGGTGCCATGCATTCCAAGCTCCAGCTGCTCAAGTATGCCGATTA
CCTGCGCATCGTTGTGCCGACGGGCAACCTGGTGCCATACGACTGGGGCGAGTCGGGCACTATTGAGAATGTACGATACG
CGCTCCTCTTTCAAAATGGACGGTACTGATCGCGGCTTATGAGTTAGATGGTGTTTATCATCGACCTTCCACGGCTCCCC
GCGCAAGCCGGCCGAATCTCTGGAAAGACTCCTTTCCTTGATGACCTGTCGTACTTTCTCAAGGCCCAGGCGGTGGATCA
GTCTCTCGTGCAGAGCCTTGACAACTATGACTTTTCGGCAACAGCACGCTACGCTTTCGTGCACACCATGTAAGCGAAGT
CGCCGAAAAGATGGAGATGTCTGGCCAAGGCCATGCTAACGGCCGGTACTCGGTAGATCTGGGTCACACGCAAAGGACTC
CTGGGAGCGCACGGGCTACTGCGGTCTGGGTAGAGCGATCAAGTCGCTAGGCTGGGCAACAGAAGAACCGCTGCAGCTAG
ACTACTTGGTAAGGCGGATCTGTTATTGTTGCTGCTTGGATGTGCAAAGCTGACGACGAGTATTTGCCGCAACAGTGTTC
ATCTATCGGATCTTTGGGTGACGATCTCCTGAATGCGCTGTACTATGCATGTCAAGGTACGATGCCGCCAGATATAATTC
GTCCGCTAGACATACAGCTGGCTGACTCTGAAAACAGGAGACACGGGGATGAAGGAGTACGAAGCCAGGGCAAATAAGCC
GAAAAAGGGCGTGCTAGCGTCGTCTTCAGAACCGGACTGGAAAAGTAGGATGCGGGTGTACTTCCCGTCTCACCAGACAG
TGGTTCGGAGCCGAGGGGGGATACGTGTGAGTGTTTGCCAATGATGGAGCCTGGCGTACGATGCGTATGTGCTGACATGG
GTACTGGAAGGGTGCGGGAACGATTTGCTTCCGGAGAAACTGGTGGGAGTCGGCCAAGTTTCCTCGAAAGATATTGAGAG
ACTACCAGAATGTCAAGAAAGGCACTCTGGCGCATACTAAGCTTCTATTTGTGCGGCGGGAAGCCAGCTCTGCGCAAGCA
TGGACGTACCTGGGAAGTGCTAATCTGTCAGAGAGCGCATGGTAAGAAGTTCCTTATAGGCAGTCGACAAATCGAAACCA
GAGCTAATGAGTCTGCGTACGAAACAGGGGACGCCTGGTGAAGGACAGGGCAACAAAGGAGCCCAGGCTGACATGTCGCA
ACTGGGAATGCGGAGTTCTGATTCCTGCGGTACCTCGGCCTGAGGCAGAACGGCGGGCAAATGTGCCTAGAGAAGGTGCT
GGTATGCTGGGTGAATTCGACAAAAGCGTACCTGTGCCAATGGTTCTGCCGGGTACAGAATACGGCGGCAAGATGGGTGG
TGGAAACTGGCCGTGGTTTTTCACAGAGGTGTGAGAGACTAGAAGGTGGAAGACATGACAGTGTAATTGACACAGTAAAC
ACACTGTAAGCGAGTGTATGACTCAGCATATAAGCGTCGCAAAATGCGATAAGACGCGGAGAAGTGGTTATCGAAAAATT
GCAGACGACAACGAATCGACTCCTCGACCCCACGGCCATGGCAGCAGTACGCAGGCAAATGATTGGCTCACTGTCAAGAC
GGGTATGTCTGCAGGTACGGCGGGGGTATCGGCAGCAGCGAGTGCGCGAACTGGCCAGCATTGCGGACGACGGACGGACA
TCATTCGACGTGGTGGTTGTTGGCGGAGGGCACGCAGGAGCAGAGGCATGTGCAGCAGCAGCACGGGCAGGGGCACGGAC
AGCACTGATCACACCGAAGCTGGACAACCTGGGAGTGTGTTCGTGCAATCCGAGTTTTGGGGGAATTGGGAAGGGGATCA
TCCTGCGGGAGATTGACGCTCTGGACGGACTGGTGGGACGGGTGGTGGACCAGGCGGGCGTACAGTTCCGGGTTCTGAAC
CGGAGCAAGGGTCCGGCAGTATGGGGGCCACGGGCGCAGATCGACCGGGGACTGTACAAGCAGCACATGCGGGAGATGCT
GGAAGGGTACCCGAACCTGTCGATTCTGGAGGGCAGCGTGTCGGACATTGTGGTGGCAGAAGCGAGGGGAGACGAGTGGA
GGATGGGGGGAGTGGAGGAGAATGGGTATGAGAAGCAGCAGGCGAGCAGGCGGATAACAGGAGTGCGGCTGGAGACGGGC
GAGGTGGTGCGGACAGGACGAGTGGTGATCACGACAGGGACATTTCTAGGGGGGGAAATCCACATCGGGATGGAGACGCG
ACCGGCAGGACGGATGGGCGAGGCGCCGACATACGGGCTGAGCCGGTCGCTGCGAGAGGCCGGGTTTGCGCTGGGACGGC
TGAAGACGGGCACGCCGCCGCGGCTGGACAGACGGACGATCGACTACGGGGCGTTGGAGGCGCAGAGGGGTGACGAGCCG
GCGGTGCCGTTCAGCTACATGGACTCGACGGTAGCGGTGAGCAGTAGGGAAGGCGGACAGCTGTTGTGCCACGCGACATA
CACGAACGCGGCGACACACGCGATTGTGCGGGCGAACCTGGACAAGACGGTGCACATCCGGGAGTCGGTCAAGGGGCCGC
GCTACTGCCCATCGCTGGAGTCCAAGGTGCAGCGATTTGGGCACAAGGAGCGGCACATTGTATGGCTGGAGCCGGAGGGA
TTCGGTAGCGACGTGGTGTACCCGAACGGGCTATCGATGACGGTGCCGGCGACGGCCCAAGAGCAGCTGCTGCGGACGAT
TGGCGGGCTGGAACGCGTGACGATGCTGCAGCCAGGCTACGGGGTTGAATACGACTACGTGGACCCGCGCGGGCTGCGGG
CGACGCTGGAGACGAAGGCGATTGCAGGTCTGTATCTGGCGGGCCAGATCAACGGCACGACCGGCTACGAGGAGGCAGCA
GGCCAGGGCGTTGTGGCAGGCATCAATGCCGGGCGAGCAGCCCAGGGACTAGAAGCCGTGCGGGCTCCTCGCGAGCAGAC
GGCTACATTGGCGTGATGATTGACGATCTGGTGACCAAGGGCGTCTCGGAGCCGTACCGCATGTTCACGACGCGGTCCGA
GTTTCGTCTGAGCGCCCGCTTCGACAATGCGGACGCTCGCCTGACGCCGCTGGGCCGCCGCTGGGGTGTCGTCGGCGATG
TGCGCTGGGCTCGTTTTGAACGCGACCGCGACCAGGCAGCTGCTCTGCGTGGCGTCCTGCAGACGACTGTGCGCAGCGCG
CCTGCGTGGCGCCGGCTCGGGTTCGCGGTGCGCGACGACTCGCGCATGCGCGACGGGCTCGACATGTTGCGGGTGGGTGG
CGTCGACGGGATCGATGACCTCGTGGCTCGCGGCGGTGTCGATGCTCTTTTGGTCGACGCCTTCTCGGCCGACATCCGCC
GTCGTGTCGCTATCGAGGCTATGTACGCGCCCTACGAGACGATCCAGAGCGTCGAGCGCGCGCGTGTGGCCCGCGATGAC
GCCCTGCGGCTGCCGACCGACCTCGACTACGCGGCCGTGGTAGGGCTTAGCCTCGCCGAGAAGGCTGTCCTCGCAGCCAC
GCGGCCAGAGTCGCTCGCACAGGCCCGCCGCGTCGAGGGCATGACGCCTGTCGGCTGCGTCCGGCTGCTGGCGCACGTGC
ACCGTACGCGACAGGCCGGTGGCAGAGACAGGCCGGCGGCAGTGCTGATTGAAGAGGACATGGAGACGTTGGATGCGGAG
GCCCGGGTGGCTGATCTGTAGGGAGGAGAGGGGAAGAGGGAGAGGGAGGAGATGAAGGGGATGAAGGGGAGAAGAGGGAG
ACAAGAGAAAGATATAAAAGTGGCAGTGTGATCGAGAATGACACGAGCAGACAACAACGGACAACTGAACGACAACTACG
ACACAGATAGACTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62