GenePrediction:GLEAN_1138 Details

Name: GLEAN_1138
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:805563..807680 (+ strand)
Length: 2118
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:805563..805789 (+ strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_173:807380..807680 (+ strand)
Length: 301
>GLEAN_1138 class=GenePrediction position=GCSC_173:805563..807680 (+ strand)
ATGGACAAGCCTAGCGGGAGCTCGGCCACAAGATCATCGCTCACTCTGGGCAAACTAGCGTACTGTGACATGGGCATCAC
TGACGGGCTGAACAGTGGATTTCGAACATGCTGGACGGCTGCTGGCAGCATACGAGCTCGACGTGCTCGTGCGAGCACGG
ACAGCATACTATGTACAGACGACGTCGTGGACTCCGTCCGCCTGGCCGTGCTCCGTCCAGGCTGCGAGTATGTAGCAGGC
AACGTTCGCGGCAGCGGTGACGGGGGCAGCTCGAGCGGAAAAGATTATCATTTCCGCATTGCCTTTACGGGCGGCCCGGA
TGGGAAGGAGAGGATAAAGCTGGGAGAATGAGTTTTTTGGTGAGAGACGGTGAGCGAGGCCAGCGGCATCGGGCAGGTGA
CCAACCGAAATCGAGACAGCTCAGCGGAGTGGACTCTTGATGCGCGCCACGCCATACTAGGGGCAAACGGCATGTTACGA
TACAAAGTTAGTAGTGTATGCATGTGGAAGAATGTGCCGAGCACACAAGCAGCAGCTCTGGTCTCGTACGAAGAAGGGCG
CCAGGCAACTTACACCGGCCGCACTATGTGCGAGGACATGGCAGCCGTTGCCTCCTCACCGATGTATGGCCTTGACGAGA
GTGTACTCGCCGGTGGGTACGAACGGGAGGCGGCAAATAGGGATCATGCCAGTGGCGGGGGGCGGGCCTGCCCATCTCTT
GGGGGGGGGGCCTAACCCAGAGTGACTGGGGAAGGGAGTAGTTGCATACTGCAAGTCAATGAGTCCTTAGTGTACAGTAC
GTACTACGAGATGGAGCCGGCTGGGTGCCGCTGCAGCACATCGTGTGCATCTGGCAGGCTATTGTCCAAGGTTGTCCAAG
GTTGTCCAAGCTTGACCTAACTTGTCCTAGGACTGGGCTTATTGTGCTCGTTGCCCTGCCGGCAGGAGATGCCGTGCCTG
ATCCTCGTGTCCTCGGCCAGCTGTTGGTGGGCTGCCGGGGCACAGAAGGACGCCGAGTCCCCCGGGCGCTCTCACCGTCT
GAGCCGCAGGATTCAGTGGTGAGGTCACAGGTGGGAAGGGGGACACGGCTCACTTCCGTGGGGGGGGGGGGGAAGAGGGG
ATGGAAGGACAAGGAAAGCGAGAGGGGGAACGGGAACTAAGAGAACGATGCACAACAGCAGATTAAGCGTCAAGGCGACG
GCTGGTAAGTGGGCAGCGGTTAGAGTGTCTCTCTTCTCCGCGTGTTTGTGCACGAACACCTGGCAACTCGCCTCCGTCGG
TCCGTCAGTGATAACGCGGCGTCAGGTACTCCGTACTCCGTACTCCGTAGACCATCGTCAGCCAAGGCACACCGCATCTT
ACAAATATTTCGTCCCTGGCCGTTTTTGGCCAACTGACCTGTCACAAAAAAGAGCAAAGTGCCAGCGCGTCGGGCGCCGA
GCTGTTGGTTCTACTCCCAAGGACTAGAAAGCGAGAGGGGCGGGGCTAGATGAGTATCGTAAACTTGTACATAGTAGGCC
TGCTAGCAGGGCCAATCCTGGTAGCGTCCACCAATATAGAGCACAGTGGCCAGCAGACAAGACGGCTCCACCCTCCGGGA
AAGCTATGGACTTGCCGCGAAACGCTTTCCGTCCAGAAGTGGTCTGGCCTGGCGGCCAGCCAGCCAGGCTGCTGTCCCAA
GAACGAGAGCCATGGGTGGGCCCTCCTTGCTGGCCAGGGGCTGTGGGTGATGATGGCTGTACGGAGTACGGAGCAGGATA
CGTGTGCTCGTATACGTGGTACAGGGGCTGTTCTTGTTGAAGCGCTGGGGCACACAGGCGCGTCCCTGTCGGTCTGGAAG
AGAAACGAAATACGGAAGATTGTGGCCAGACTGCTTTTAGCGGGCGTGAGAAGATAGGGGACCATGAGTGGCCCGTCATT
GCATTGCGTGGTGCGTGTGGAGGAAAGGTCAGGCGATTGCGCACAGGCGTGCCACTGGCCGAACCCAGAGCGTCTGCCAA
GAACCAAGAAGAGAGGCACAGGAGTATGGAGTACGAGTGGCATACGCCCAACGCTGGACAGACAGCAGGAATACGGAAGA
CAGTACGGGTGGAAAGGTGGGAGAAGCGGTCCTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62