GenePrediction:GLEAN_1139 Details

Name: GLEAN_1139
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:812910..813916 (+ strand)
Length: 1007
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:812910..813369 (+ strand)
Length: 460
Type: CDS
Source: GLEAN
Position: GCSC_173:813426..813916 (+ strand)
Length: 491
>GLEAN_1139 class=GenePrediction position=GCSC_173:812910..813916 (+ strand)
ATGGCTACCAATCGGCAGGTGTGGGAGGTCAAGGAGCCGTATCTGAACGCGCACTGCCTCCTGGGCGAGGGGCCGTTCTA
CGAGACCGAGTCCAACAGCGTGCGCTTCGTCGACATCCGCAAGCGCCAGCTGCTGACGGTCGACCTGGCAGCCGGACCAT
CGTCGCTGCAGGTCCTCCAGCTCGACTTGGCCATCTCGGTGACGGCCGACATCCGCGGCGTCGATCCGCGCGAACAGGTC
CTGGCCGGCCTCAAGCACGGCCTCGCAGTGCTGGACCGCAAGACGGGCTCGTACGAATATGTGCGCAAGTTTAGCGAGTG
CGCCAACACGAGCGGCGATGTCGCGGCCGATGCTATTGACTACAACCGTGTGCGTGGCAACGACGGCGCCGCCGATCCGC
ACGGCCGCTTCTGGCTCGGCACCATGACCGACTTCGATCTGGGCGAGTTCCAGCCGGAAGGTGAGTCTTTGCCGTCTCCT
ATCCTCTGTCTTTCCGTCTCGCGCTCACAACCACAGGCGCCCTCTACCGCTTTGACGGAGCCAAGTCGGGCGAGCTGACC
CAAGCCGGCCTCACCATCCCCAACGCCATCGGCTGGTCGCCCGATGGCAGCGTCATGTACTTCACCCACACGACCGCAAA
CACGCTCTACGCCTTCGACTACAGCCCCGTCGACGGCAGTCTGTCCAACCGGCGCGCTCTCTACGTCCATCCCGGCCCGG
GCTCGCCCGATGGCTTCCGTGTCGACGTCGACGGCTACATCTGGCACGCCATTTACGGCGGCAGTTGCGTCCTCAAGATC
TCGCCCGTCGACGGCCGAGTTGTTGGCGAGGTCCGCCCGCCCACCCCCAACATCACGTGCACCCAGTTCGTCGGCACCGA
GCTCTTCATCACCACCGCCGCCAACAAGGAAGACACGCCCGAGCCTGACGTGCTGGGCGGCGCTCTCTTCCGCATCGACG
TCGGTGTCAAGGGGCTGCCTCCCTACCGCTTCCACAAGGACACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62