GenePrediction:GLEAN_113 Details

Name: GLEAN_113
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:773084..776168 (+ strand)
Length: 3085
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:773084..773348 (+ strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_179:773603..773785 (+ strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_179:774134..774644 (+ strand)
Length: 511
Type: CDS
Source: GLEAN
Position: GCSC_179:774842..776168 (+ strand)
Length: 1327
>GLEAN_113 class=GenePrediction position=GCSC_179:773084..776168 (+ strand)
ATGGTGATCGAGACCAACACCAGCTGGTTCCAGCTGGTACCAGCTGGCGTATACGCTGACTTTTCAGTTTGTCCCGCCTT
TAGCCGCGGCCAGTGGCGATCAGCTAATAATGCCGCTGCTGAGCCGGAGATTCGGTCAGCTGTTCTTCCGCATTACGGAC
GCACAATGGGTGGCATGTCATGGCCCCGAAAACCAGAAATCGGCGGTGGTGCGACTAATCCGACTCTGGCAGCTGCAAAG
GCAATGGCGCTTATCGGCCCCACGCGTTTTGTGCGCCTGGTGTTATCAGCGACGGTCATGCCCTTCAACTGGCTCGCACC
TTCTTCTCTCGATCGACCCGCGTTGCTTAGTCACTGACGAACCCGCCACAGGAATGCCATTGTGGCAGCAGAGCAAACAG
AGCTAGCAGATTTAGCAGAGTTAAGCAGGGAAATGGGACGGACCAGAGCATCGAGATCGAAAAAAGAGCCACCAGTGCGA
GGCGTGCCGGGTCTTATTTTCCCTGATCATCCACCGTAGGCTCACGCAACCATTGGCCGAGCGCCGTCGTGCTGCCTTAT
CAGGAAGGTGGTCGGTCCTTTTTCTGCCTGGCTCTTTGTCTCTGGCTCGACAACAGGCAACTGGCCGAGGGTGGTGTCAG
CCAGAAGGATGGAACAAATGGACCTAGGCCATACGAGCGCGAGGACTCGACAGCGTCTGAACGTGACAATGGCTGATGGG
CCGTGGCGCATAGGACGGACGGTGTTCCCCTTTCCCGCATCCCCGCGCGACCTTATCTTTCTCTTAAAACGCTTAGCACC
CCGGCCCCCCCGGTTCTTCTTTTTGTTCTGCAGTCTTCTTTTTCTTGGCTCTCTCCACCGTTTCTTCCTCGTTTCGCTTG
GCAGCCATTCTGCATTGCACTTACAGCCTACTGCGTTATTGCTAGACGCCAAGACGGCAGTTAGTTCGTCTTGTCCATAG
TCTTGTCAGATCTTGGATTTTCAGTATTCATTTACCAACAATTGATTGCTCCCGCTCTGCCTCCGCTCAATTCCACGATG
GCAAAACCAGGGAACATGGCCGTTGACGGCACAGACCCACGCACATACGACCACATGCAGGCTGGCGATGGGGCCGTGGG
CGAGGTCACGGTGGCGTCGCTGACAGGAAGTCGTGCGGATGCGCATCACGGGCGCAACCTCTACAACCCCAACATCACCT
TTGAGGAGTACCACTACTACGCGCAGCAGACACGAGCCGAGGAGGCCACTCAGCCACTGACGGCCTACGAAACCACCATC
TGGTCGCTCATCTTCCCACCCAAGTCGGGCGAGGGCGTGAAGCGAGCCGAGCAGGACAGCCCAGCCGGCGTCGCGGCCGG
CTCTCTGGACGAGAAGACGGGCGACAAAGAGGCATTGCCAGCCAGCGGCGATGGTGGCCAGGCCGCTGTCAGCGACGAGG
AGTGGACCAACGCGTCACGAGCTCTGCGCACAGCCACCCGGGGCGCCATCTTCTACCTGATCACGACCGACATTCTGGGG
CCGTTTGGGCTGCCGTACGCGTTTGCGACTATGGGCTGGGGGTGAGAAATTTCTGTCCTGTTTGTTGTCTTGCATCTTTT
TCCTTCTCCACCGTCGTCTTGGCCAAGCTTTTCAGCTGCCGTCTTGGCAAAGCTGCGTTCCGATTAGCGTCCCTAGGTGC
AAATCATCAGTGGAGAGCACTAAAACTCTAGCAGAATGGAGCAGCGCTAACATATCTTTCTTCTCTTTTTTCGCACAGAC
CTGGCGTGGCCCTGTTTACCGTGTTTGCCGGGCTTGCAGGCTATTCTGGCTACCTGCTCTGGGGCGTCTTCCTCGGGCTG
GATTCGTACCAGTATCCGGTGCGCAGCTTTGGCGATTTGGGCTACCGTCTGTACGGCCCGTGGTTACGGTACCTATTCAA
CTTCTTGCAGTCGGTGCAGCTGCTGCTCAATGTCGGCCTGATTGTCATCTCCAATGGCGAGGCGCTGTCGCAGGCTGCCA
AGTTCCGGCTCTGCTTCATCGTCTGCTGCCTCGTCTGGGCCATCGTCGGCTTCCTCGTCGGCCAGATCCGCACGCTGCAA
AAGTTTGGCTGGCTGGCCAACGTGGCCGTCTGGCTCAACCTGCTCTGCATGTTCGTCACCATGGGCGCGGCTGCCCACTC
GTCTCCCAACTACACCGGTGCCGCCATGTCGGCCGGCGCATCTATTCAAGGCGGCGCCGTCGTCACGCCCAACGCCCAGG
GCGTCTACCCGCCCGTGCAGACGAGCGGTGGCATCCCCGACACCGGCGGCTTCACCGCGTCTGTCAGCGGCGCCATGCAG
GCCATCTTCGCCTACGGTGGCTCCATGGTCTTCCCCGAGTTCATGGCCGAGATGAAGCGGCCCAAGGATTTCCTGACGGC
CATGTGGGCTGCCCAGGCGTTCATCTACTTCTGGTACATGCTCTACGGCCTCTTCATGTACGGCTACCAGGGCCAGTACG
TCATCAACCCAAGCTATCTCGGCATCGGCAAGTACAGCCTCCAGACGGCCGGCAACGTGTTCGCCATGGTCAGCGCCGTC
ATCGCTGCCGCTCTCTACGGCAATATCGGCATCAAGGTACTCTACAACAACATCTGCGTCGAGTTCTTCCGCGCGCCTCC
CCTGCAAACCTTTGCCGGCAAGGTCATCTGGGCCGGCCTGATTCCCATCTACTGGGCCATTGCCTTTATCATCGCCGCCG
CCATTCCCAACTTCTCCGGCCTCACCTCTGTCGTCGCCGCCTTCTGCATCCTCCACTTCACCTACACCTTCCCGCCCCTC
CTCTCGATCGGCTACCTGATTCACAAGCACGCCATGCGGCCGGCCGATGGCGAGGGCTTCGACCCGGCCACCGGTAATGT
CACCCGCCTCGACTCGGGACCCCGCCGCTGGATCCGTGGCTTCCTGGCCTACCGCTGGTGGATGAACTCGGCCAACGTCA
TCTACATGCTCGGCGCTCTCGCCCTCGGTGGCCTGGGCGCCTACTCGTCTATCGAGGTGCTGAAAGCCGCCTTCAAGACA
AGCACGACGACCTCCTTCACCTGCAAGAGCCCATTGAACGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62