GenePrediction:GLEAN_1140 Details

Name: GLEAN_1140
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:819796..821703 (+ strand)
Length: 1908
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:819796..820118 (+ strand)
Length: 323
Type: CDS
Source: GLEAN
Position: GCSC_173:820311..821703 (+ strand)
Length: 1393
>GLEAN_1140 class=GenePrediction position=GCSC_173:819796..821703 (+ strand)
ATGTCGTTCTCCGTTTTCTCCAAATTCCCCTCATCTCGCAGACTTGCACGTCTTCCCCGAGTGCTCGCTGCTTCCCCCAG
ATGTGCCCCAAGCCACAGGGCGTTTAGCGCTGTTTCTAGACAGTCGTCCTTCTCGCCTAGGGCTCAGCTCAACCGGACGG
GTGCCTCTCTGCAGCGGTATTCCACCGCAACATTGCCGACCGGCCTTGAGGTTGAGATCACTGCACCAAACGGCCAGACC
TGGTTGCAGCCGCAGGGCCTGTTCATCAACAATGAATATGTCAAGAGCAGCACGGGCGACACGGTCGTGACCATCAACCC
CACGTAAGTTCTCGTAATTTTCTTTTCCCCTTTTTTCTCCTCGTAGCCCCAAATCCCCGACCCCTCATCCCGCATTGTCT
GCATCACGCATCCCACAATTTCGAATCCTACATCCCGCATCCTGCATCGGACATCCCACGTCATCCCACGTCCCCGGACG
CAAGACAAAATTCCCGGCTGACACTGAAACACCAGCACCGAGGAGGAAATCTGCGCTGTTTATGCCGCATCGGCCAAGGA
TGTCGACACGGCCGTCAAGGCGGCCCGCAAGGCCTTCCGCGACCCGTCGTGGAAGAAGCTGTCGGGCACCGAGCGCGGCA
AGCTGCTGTACAAGCTGGCTGACCTGGCCGAGAAGAACGCCGAGATCCTGGCCACGATCGAGACGCTTGACAACGGCAAG
CCGTACAAGACGTCGCTCAACGACAGCGTGACTGAGTTTGTTGACACGCTTCGCTACTATGCCGGCTGGGCCGACAAGGT
CCAGGGCAACGTCATCGACGTCGGGCCCAACAAGATGGCCTTTACCGTCCACGAGCCGCTGGGCGTTTGTGGCCAGATCA
TCCCCTGGAACTTCCCCCTCGAGATGGCCGCCTGGAAGCTGGGTCCGGCTCTCGCCTGCGGCAACACCATCGTGCTCAAG
CTGGCCGAGCAGACCCCGCTGTCGATGCTGTACATGACCAAGCTCATCAAGGAGGCTGGCTTCCCGCCCGGCGTTATCAA
CGTTATCAACGGCTACGGCCGTGAGGCCGGTGCCGCCCTCTCCCAGCACGAGGACGTCGACAAGATCGCCTTTACCGGCA
GCACGGCCACCGGTCGAGAGATCATGAAGATGGCCGCCAGCAACCTTAAGAACGTCACACTTGAGACCGGTGGCAAGTCG
CCGCTGCTCGTCTTCTCAGACGCTGATCTCGACCTGGCTGCCACTTGGGCCCACTCGGGCATCATGTACAACCAGGGCCA
GATCTGCACGGCCACGTCGCGCATCCTCGTCCACTCTTCCGTTCATGACCGCTTCGTCGAGCTGTTTAAGGCCGCCGTCT
CCGAGGTCTCCATCGTCGGTGACCCCTTCCACGAGGATACCTTCCAGGGTCCCCAGGTCACCCGTGCCCAGTATGAGAAC
GTGCTCCGGTTCGTCCAGGTCGGCCAGGACGAGGGCGCCACCCTTGTTATGGGCGGTCGTCCCAAGGGCGGCCCGTTGGC
ACACGATGGCCACACAAACAAGGGCTTCTTCGTCGAGCCGACCGTGTTCACAGATGTGACGCCGAACATGACCATTTTCC
GCGAGGAGATCTTCGGACCTTGTGTGGCTATTGCCAAGTTTGAGACTGAGGAGGAAGCTTTGGAAATGGCCAACGACTCA
ACGTACGGCCTAGGTGCTGCCGTCTTCACCCGCAACCTGACCCGGGCTCACCGCGTGTCCCGTGAGATCGTTGCTGGCAT
GGTGTGGATCAACAGCAGCAATGACATTGACTTCCGCGTGCCGTTTGGCGGTGTCAAGCAGTCTGGTATCGGCCGGGAAC
TCGGCGAGGCCGGCCTGGCGGTGTACAGCACGTCGAAGAGCATCCACATCAACATGGAGGCGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62